ID: 1062393589

View in Genome Browser
Species Human (GRCh38)
Location 9:136343608-136343630
Sequence GCCCACAGCCTAAACTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062393589 Original CRISPR GCCCACAGCCTAAACTGCAG GGG (reversed) Intronic
900248616 1:1653358-1653380 TCCCCCAGCCTAGAGTGCAGAGG + Intronic
902027161 1:13392619-13392641 TCCCTCAGGCTAAAGTGCAGTGG + Exonic
902441863 1:16435653-16435675 GTCCACAGGCTGGACTGCAGTGG + Intronic
904190787 1:28742087-28742109 GCCCACAGGCTGGAGTGCAGTGG + Intronic
904267652 1:29326850-29326872 GCCCCCAGCCTCCAGTGCAGTGG + Intergenic
905880990 1:41463700-41463722 GACCACAGCCTAGACTTCAGGGG - Intergenic
907198546 1:52706700-52706722 GCCCCCAGCCTGGAGTGCAGTGG + Intergenic
908297252 1:62725067-62725089 GCTAACAGCCAAGACTGCAGTGG - Intergenic
910161304 1:84275614-84275636 AGCCAGAGCCTAAACTTCAGGGG - Intergenic
912188204 1:107306030-107306052 TCTCACAGCCTAGACTGAAGAGG - Intronic
912862692 1:113228736-113228758 GATCACAGCCTAAGCTGCAGAGG + Intergenic
912873220 1:113328705-113328727 ACCCACAGGCTAAAGTGCTGTGG - Intergenic
916475223 1:165162531-165162553 GCCCAGAGCCTTCTCTGCAGAGG - Intergenic
916723802 1:167505168-167505190 TCTCCCAGCCTAGACTGCAGTGG + Intronic
917012670 1:170491610-170491632 TTCCCCAGGCTAAACTGCAGTGG - Intergenic
918433181 1:184483617-184483639 TGTCACAGCCTAAACTACAGTGG - Intronic
921247702 1:213262564-213262586 GCCCTCATCCTAAACTGCTTAGG + Intronic
922181718 1:223241129-223241151 AACCACAGCCAAAACTGCTGGGG - Intronic
922562393 1:226578729-226578751 GCCCACAGCCACCCCTGCAGCGG + Intronic
923582896 1:235235368-235235390 GCCCACAGCCTAAATATTAGGGG + Intronic
1062899612 10:1132931-1132953 GGCCACTGCCTAAGCTGCATTGG + Intergenic
1065500459 10:26376696-26376718 GCCAACAGCATCATCTGCAGCGG + Intergenic
1065920702 10:30390363-30390385 CCCCCCAGGCTAAAGTGCAGTGG + Intergenic
1066959746 10:42210058-42210080 GCCCACAGCCTATAGTGATGGGG - Intergenic
1067896056 10:50180659-50180681 ACCCACAGCCTATACTGAATGGG - Intergenic
1067952922 10:50761340-50761362 ACCCACAGCCTATACTGAATGGG + Intronic
1068990006 10:63140455-63140477 TCCCACAGACTAGAGTGCAGTGG + Intronic
1069460036 10:68586046-68586068 GTCCCCAGGCTAAGCTGCAGTGG + Intronic
1069540718 10:69291956-69291978 GCCCAAAGCCAAAACTGCCTAGG - Intronic
1069778973 10:70943091-70943113 GCCCGCAGTGTAAACTGCTGGGG + Intergenic
1070281894 10:75055947-75055969 TCCCTCAGGCTAAAGTGCAGTGG + Intronic
1070761808 10:79028623-79028645 GCCCACACCCCAAACAGCAAGGG - Intergenic
1072121233 10:92407103-92407125 GCCCACAGCCTTCACTGGTGAGG - Intergenic
1072192319 10:93086150-93086172 TCACACAGCATAAGCTGCAGAGG + Intergenic
1072799625 10:98384086-98384108 GCCCACAGTCTCAACGGCTGAGG + Intronic
1073363313 10:102917754-102917776 GCACACAGCCTAAAAAGCCGGGG - Intergenic
1076228966 10:128804055-128804077 GCTCACAGCCTGGCCTGCAGGGG + Intergenic
1077154431 11:1085059-1085081 GCCCACATCCTTGTCTGCAGAGG - Intergenic
1077172484 11:1174129-1174151 GCCCAGGGGCTAAACTTCAGGGG + Intronic
1077478953 11:2803970-2803992 GGCCGCAGCCCCAACTGCAGCGG + Intronic
1081537444 11:44005947-44005969 GCCCAAAGGCCAAAGTGCAGGGG + Intergenic
1082783918 11:57306236-57306258 GCTCCCAGCCTGAAGTGCAGTGG - Intronic
1083046080 11:59736080-59736102 GGCCACTGTCTAAACCGCAGAGG - Intronic
1087099636 11:94351862-94351884 TCCAAACGCCTAAACTGCAGTGG + Intergenic
1090357030 11:126147115-126147137 ACCCACAGCCTGACCCGCAGCGG + Intergenic
1091209707 11:133845628-133845650 ACCCAGAGCCTGAAATGCAGGGG - Intergenic
1091267560 11:134282673-134282695 GCCCCCAGCCCAGACTGCTGAGG + Intronic
1092494681 12:8980802-8980824 ACCCACAGCCTTAACTGCCAAGG - Intronic
1094730661 12:33170946-33170968 TCCCCCAGACTAAAGTGCAGTGG + Intergenic
1095637645 12:44452006-44452028 TCCAAACGCCTAAACTGCAGTGG + Intergenic
1097473990 12:60031606-60031628 ACTCAAAGCCTAAAATGCAGTGG + Intergenic
1098838685 12:75452827-75452849 AACCAGAGCCTAACCTGCAGGGG - Intergenic
1100331670 12:93588654-93588676 GCCCAGAGACTAGACTGCAATGG + Intergenic
1101324818 12:103706359-103706381 GCCAAAAGCCTCACCTGCAGAGG + Intronic
1102061084 12:109931594-109931616 GCCCACCGCCTACACAGTAGGGG - Exonic
1103351935 12:120290061-120290083 GTCCACAGCTTGAACAGCAGGGG - Intergenic
1103592279 12:122000510-122000532 TCACCCAGCCTGAACTGCAGTGG - Intronic
1103751916 12:123170015-123170037 TCCCCCAGGCTAAAGTGCAGTGG + Intronic
1105774179 13:23641370-23641392 TCACCCAGGCTAAACTGCAGTGG + Intronic
1107128668 13:36871595-36871617 GCACAGAGCCTGAAATGCAGTGG - Intronic
1107663653 13:42665811-42665833 AACCACAGCCTAATCTGCCGGGG + Intergenic
1108720610 13:53127650-53127672 TCCCCCAGCCTCAACTGTAGAGG + Intergenic
1109892309 13:68631250-68631272 TCCCTCAGGCTAAAGTGCAGTGG - Intergenic
1112562446 13:100526429-100526451 GCCCACCACCTGAACAGCAGAGG + Intronic
1114862217 14:26538042-26538064 GTCTACAGCATAAACGGCAGGGG + Intronic
1115521731 14:34239756-34239778 GCCCTCAGTCTAAACTAGAGTGG + Intronic
1119118557 14:72051134-72051156 GACAACAGCCTCAAATGCAGTGG + Intronic
1121884131 14:97527372-97527394 GTCCACAGCATAAAATGCAGAGG - Intergenic
1122492617 14:102129540-102129562 TCGCCCAGCCTAAAGTGCAGTGG + Intronic
1124239480 15:28017859-28017881 GCCCAGAGCCTAGACTCCAGAGG - Intronic
1126011115 15:44303603-44303625 TCACCCAGGCTAAACTGCAGTGG + Intronic
1129000646 15:72330526-72330548 TCACACAGGCTAAAGTGCAGTGG + Intronic
1129282226 15:74494771-74494793 TCACACAGCCTACAGTGCAGTGG + Intergenic
1131442061 15:92466889-92466911 GCCCACACCAGGAACTGCAGTGG - Exonic
1132041050 15:98524907-98524929 CCCCACAGCATAACCTGTAGGGG - Intergenic
1132161984 15:99550862-99550884 GTCCCCAGGCTAAAGTGCAGTGG + Intergenic
1132557928 16:580614-580636 CCCCACAGCCTCACATGCAGAGG - Intronic
1133086373 16:3366897-3366919 TCCCCCAGGCTGAACTGCAGTGG + Intronic
1133092938 16:3418757-3418779 TCCCCCAGACTAGACTGCAGTGG - Intronic
1133316661 16:4888937-4888959 GCCCAAAGCACAAACAGCAGGGG - Intronic
1133916074 16:10111303-10111325 GCCCACAGCGTCAGCAGCAGCGG + Intronic
1134484718 16:14648568-14648590 GCTCACAGCTTTAACTGGAGTGG + Exonic
1136113870 16:28082198-28082220 TCCCCCAGGCTAAAGTGCAGTGG - Intergenic
1138176345 16:54901525-54901547 GACCACAGCCTAACCTGATGGGG + Intergenic
1140042071 16:71414655-71414677 TCACACAGCCCAAAGTGCAGTGG - Intergenic
1140295883 16:73709323-73709345 TCACACAGCCTAGAGTGCAGTGG - Intergenic
1143493845 17:7299470-7299492 TCACTCAGGCTAAACTGCAGGGG - Intergenic
1144046631 17:11459966-11459988 GTCGACAGCCTCAGCTGCAGAGG + Intronic
1145756535 17:27395835-27395857 TCCCCCAGCCTATAGTGCAGTGG - Intergenic
1146020934 17:29278284-29278306 TCCCCCAGGCTAGACTGCAGTGG + Intronic
1146977808 17:37130700-37130722 ACCCTCAGCTGAAACTGCAGTGG + Intronic
1150735122 17:67730298-67730320 GCCCAGAGGCTAGAGTGCAGTGG + Intronic
1151448227 17:74181222-74181244 GCTCAGAGCCTAAAGTGCAGAGG - Intergenic
1152771596 17:82172965-82172987 GACCACAGCCCAAGCTGAAGCGG - Intronic
1152822488 17:82444433-82444455 TCCCACAGCCTTACCTGCGGTGG + Exonic
1156407358 18:36795538-36795560 GCCCACAGCCAGGACTGTAGAGG + Intronic
1157684429 18:49631085-49631107 GCCCACAGCGTAAAGCCCAGAGG + Intergenic
1159237275 18:65692914-65692936 GCCTACAGCGTTCACTGCAGTGG - Intergenic
1159954528 18:74510035-74510057 GCCCTCAGCCTCAGCTGCAGTGG + Intronic
1160880451 19:1317321-1317343 TCCCCCAGGCTAAAGTGCAGTGG - Intergenic
1162097691 19:8320892-8320914 TCCCACAGCATGACCTGCAGGGG - Exonic
1162856529 19:13472783-13472805 TCACCCAGCCTAAAGTGCAGTGG + Intronic
1163902329 19:20114249-20114271 TCTCCCAGGCTAAACTGCAGTGG - Intronic
1163925747 19:20341825-20341847 TCTCCCAGGCTAAACTGCAGTGG + Intergenic
1165147819 19:33743049-33743071 GCCACCAGCCTATATTGCAGAGG - Intronic
1165374425 19:35431713-35431735 TCCCACAGGCTAGAGTGCAGTGG + Intergenic
1166838996 19:45684746-45684768 GCCCACAGGCTGGAGTGCAGTGG - Intergenic
1168043679 19:53778848-53778870 TCACCCAGGCTAAACTGCAGTGG + Intergenic
1168523303 19:57069589-57069611 CCCCCCAGGCTGAACTGCAGTGG + Intergenic
925051500 2:819252-819274 CCCCGCACCCTAATCTGCAGTGG + Intergenic
925649554 2:6074624-6074646 GCTCACACCCTAAACATCAGTGG + Intergenic
927164530 2:20304168-20304190 CCCCAAAGCCTGAACTGCATAGG + Intronic
929196711 2:39192398-39192420 TCCCCCAGGCTAAAATGCAGTGG + Intronic
929466084 2:42145376-42145398 GCCCCCAGGCTAGAGTGCAGTGG + Intergenic
929540522 2:42816388-42816410 CCCCCCAGCCTAGAGTGCAGTGG + Intergenic
931183185 2:59923966-59923988 GCCCACAGCATATACGGCAGGGG - Intergenic
933207296 2:79521845-79521867 GCCCACAGCATGAACTGGAGGGG + Intronic
933788329 2:85862592-85862614 ACCCACAGCCTAAGCAGCACAGG + Intronic
934325158 2:92007028-92007050 GCCCACAGCCTATAGTGATGGGG + Intergenic
934871268 2:97868532-97868554 GCCCACAGACTGCACTGGAGAGG + Intronic
935789917 2:106581478-106581500 GCCCACAGCCAGCACCGCAGTGG + Intergenic
936470471 2:112794237-112794259 GTCCCCAGTCTAAACTGCAAGGG - Intergenic
937674197 2:124571570-124571592 ACCCACAGGCTAGAGTGCAGTGG + Intronic
938188336 2:129253066-129253088 GCCCACAGCCAAATCTTCATGGG - Intergenic
938668010 2:133559356-133559378 TCTCACAGCCTAGAGTGCAGTGG + Intronic
938963446 2:136363399-136363421 TCGCACAGCCTAGAGTGCAGTGG - Intergenic
941616227 2:167723568-167723590 GCCCCCAGGCTAAAGTGCAGTGG + Intergenic
941935901 2:170981137-170981159 TCCCAACGCCTAAACCGCAGTGG - Intergenic
942674038 2:178407623-178407645 ACCCACAGCCTCTACAGCAGGGG - Intergenic
943951297 2:194134377-194134399 CCCAAATGCCTAAACTGCAGTGG - Intergenic
944660006 2:201913747-201913769 TCCCCCAGCCTCAGCTGCAGGGG - Intergenic
945244600 2:207706670-207706692 TCCCCCAGGCTAAAGTGCAGTGG + Intergenic
946264104 2:218523221-218523243 CCCCACAGGCTAGAGTGCAGTGG - Intronic
946301120 2:218824563-218824585 GCCCACGACCTGACCTGCAGAGG + Exonic
946730864 2:222708121-222708143 TCCCCCAGGCTAAAGTGCAGTGG + Intronic
1170866722 20:20164328-20164350 GCCCACATCCTAATCTCCTGGGG + Intronic
1172543990 20:35745124-35745146 TCCCACAGGCTGAAGTGCAGTGG + Intergenic
1172552945 20:35815994-35816016 TCCCCCAGACTAGACTGCAGGGG + Intronic
1172614634 20:36275154-36275176 GCCCACAGCCTCATCACCAGAGG - Intergenic
1174492354 20:50909321-50909343 GCCCACAGGCTGGAGTGCAGTGG - Intronic
1176594582 21:8680841-8680863 GCCCACAGCCTATAGTGATGGGG + Intergenic
1178303756 21:31473388-31473410 TCCCCCAGCCTAGAGTGCAGTGG - Intronic
1179488427 21:41725768-41725790 GCCCACTGCCCACTCTGCAGGGG + Intergenic
1179490688 21:41739731-41739753 GGCCACACCCCAAACTGCTGAGG + Exonic
1180277434 22:10657970-10657992 GCCCACAGCCTATAGTGATGGGG + Intergenic
1180873668 22:19163367-19163389 GCCCCCAGGCTAGAGTGCAGTGG + Intergenic
1183885285 22:40875213-40875235 TCTCCCAGGCTAAACTGCAGCGG + Intronic
1184490370 22:44804833-44804855 GACCACAGCTGAAACTGCAGTGG + Intronic
1185237267 22:49721461-49721483 GCTCCCAGCCTGAACTCCAGGGG + Intergenic
1185343249 22:50300725-50300747 ACCCAGAGCCCAGACTGCAGGGG - Intronic
950149042 3:10671952-10671974 GCCCACAGTGCAAACTGCAGGGG - Intronic
950869489 3:16216457-16216479 GCTCGCAGGCTAAAGTGCAGTGG - Intronic
951502983 3:23411176-23411198 ACCCACAGCCTCAACTGAGGCGG - Intronic
955645194 3:61130023-61130045 GCACACAGCCTAGAATGTAGTGG - Intronic
956718534 3:72098942-72098964 GCCCACATCCTCATCTGCATGGG - Intergenic
958475332 3:94573569-94573591 TCCAACAGCATAAACTGCATTGG - Intergenic
959078893 3:101779482-101779504 GCCCACAGCCACGACTCCAGGGG - Intronic
961311957 3:126007909-126007931 GCACACTGCCTAGACTGCAGCGG - Intronic
966085422 3:176063546-176063568 TCCGAACGCCTAAACTGCAGTGG + Intergenic
966807177 3:183816876-183816898 TCCAACAGCTTCAACTGCAGGGG + Exonic
967752223 3:193127885-193127907 TCACACAGGCTAAAGTGCAGTGG + Intergenic
968458433 4:711091-711113 GCCCACACCCTCCACTGCACAGG + Intronic
968769076 4:2492157-2492179 GCCCCCAGGCTGGACTGCAGTGG - Intronic
968888900 4:3355753-3355775 TCCCCCAGCCTAGAATGCAGCGG - Intronic
970980949 4:22096316-22096338 GTCCACAGGCCAAACTCCAGGGG - Intergenic
971703764 4:30013193-30013215 GCCCACAGCCGCAACAGCAAGGG - Intergenic
972527694 4:39931929-39931951 TCGCCCAGGCTAAACTGCAGTGG + Intronic
976065241 4:81179678-81179700 GAAAACAGCCAAAACTGCAGGGG + Intronic
977782449 4:100995282-100995304 TCCAAAAGCCTAAACTGCAGAGG - Intergenic
978651045 4:111005696-111005718 TCCTACAGCCTAGACTGTAGTGG + Intergenic
979824050 4:125211044-125211066 TCACCCAGCCTAGACTGCAGTGG + Intergenic
979935151 4:126684725-126684747 TCCCTCAGGCTAGACTGCAGTGG + Intergenic
984161777 4:176261135-176261157 GCCCATTTTCTAAACTGCAGAGG - Intronic
984828127 4:183946663-183946685 TCGCACAGGCTAGACTGCAGTGG + Intronic
985193385 4:187401931-187401953 GCCCAAAGTCTAAATTCCAGGGG - Intergenic
986502793 5:8417784-8417806 AACCACAGCCTAATCTCCAGGGG + Intergenic
988211001 5:28203128-28203150 GCCCATATCGTAAACTTCAGTGG + Intergenic
989468882 5:41791841-41791863 GCCCACAGGCTGGAGTGCAGTGG + Intronic
992386611 5:76290713-76290735 TCCCACAGCCTAACCCACAGTGG - Intronic
993816858 5:92559122-92559144 GCTAACAGCCTAATTTGCAGTGG - Intergenic
994236522 5:97369351-97369373 GCCCACTGTCTTGACTGCAGAGG - Intergenic
995516815 5:112962461-112962483 TCCCCCAGGCTAAAGTGCAGGGG + Intergenic
996441513 5:123496603-123496625 TCACACAGGCTGAACTGCAGTGG + Intergenic
996491515 5:124103498-124103520 TCCCCCAGGCTAAAGTGCAGTGG - Intergenic
996526418 5:124484974-124484996 CCCCAGAGCCTAGACTGCAGAGG + Intergenic
997297051 5:132775023-132775045 GCTGACAGCCCAAAGTGCAGAGG + Intronic
1000438575 5:161242175-161242197 TCCAAATGCCTAAACTGCAGTGG + Intergenic
1001652365 5:173324929-173324951 GCTGGCAGCCTAAACTGCAGAGG - Intronic
1003572735 6:7266665-7266687 GCCCAGAGACTGAAGTGCAGTGG + Intergenic
1005284934 6:24315293-24315315 GCCACCAGCCTTTACTGCAGTGG + Intronic
1006515695 6:34544457-34544479 GCCGCCAGCCCAAACAGCAGCGG - Exonic
1006766721 6:36513057-36513079 TCCCCCAGGCTAAAGTGCAGTGG + Intronic
1009767336 6:68097460-68097482 ACCCAGGGCCTAAAGTGCAGTGG + Intergenic
1011212809 6:84972338-84972360 TCCCACAGGCTGAAGTGCAGTGG + Intergenic
1014190779 6:118494406-118494428 TACCAGAGCCTAAACTGCTGGGG + Intronic
1016186233 6:141200532-141200554 TCCCCCAGGCTAAAGTGCAGTGG - Intergenic
1017175653 6:151502231-151502253 GCACACAGCCTGGAGTGCAGTGG - Intronic
1017346330 6:153386471-153386493 TCCCCCAGGCTAAAGTGCAGTGG + Intergenic
1018053639 6:160033174-160033196 GCGCCCAGGCTAGACTGCAGTGG + Intronic
1019298606 7:291508-291530 GACCCCAGACTGAACTGCAGGGG - Intergenic
1019401693 7:858088-858110 GCACGCAGGCTAGACTGCAGTGG + Intronic
1025026232 7:55518510-55518532 TCTCACAGCCAAAACAGCAGGGG + Intronic
1025782044 7:64610523-64610545 ACACACAGGCTAGACTGCAGTGG + Intergenic
1027259904 7:76457393-76457415 GTCCACAGCCTAAGGGGCAGTGG - Intergenic
1027282568 7:76619497-76619519 GTCCACAGCCTAAGGGGCAGTGG + Intronic
1027311276 7:76955497-76955519 GTCCACAGCCTAAGGGGCAGTGG - Intergenic
1028214109 7:88110780-88110802 TCCCACAGGCTGAAGTGCAGTGG + Intronic
1029112119 7:98217833-98217855 GCCCTCAGCCCTACCTGCAGTGG + Intronic
1032124379 7:129181923-129181945 GCCCCCAGCCTGGAGTGCAGTGG - Intergenic
1032462550 7:132122647-132122669 GCCAACAGCAGAAACTGCAGAGG + Intergenic
1033596710 7:142864327-142864349 TCCCACAGCCCACGCTGCAGAGG - Exonic
1034163214 7:149007335-149007357 GCCCACAGCCCAAACAGCCAGGG + Intronic
1034316571 7:150138659-150138681 GAGCACAGACTACACTGCAGAGG - Intergenic
1034790289 7:153962015-153962037 GAGCACAGACTACACTGCAGAGG + Intronic
1036564721 8:9928734-9928756 GCTCTTAGCCCAAACTGCAGAGG - Intergenic
1037338022 8:17810790-17810812 ACCCCCAGCCTGAAGTGCAGTGG - Intergenic
1040059796 8:43094036-43094058 GCCCCCAGGCTGAAGTGCAGTGG - Intronic
1040478034 8:47797920-47797942 GGCCACAGCCTCATCTGCAGGGG + Intronic
1042240283 8:66656943-66656965 TCCCCCAGCCTGAAGTGCAGTGG + Intronic
1042906051 8:73773372-73773394 CCCCACCACCTAGACTGCAGTGG - Intronic
1044354331 8:91203429-91203451 TCACCCAGCCTAAAGTGCAGTGG + Intronic
1046074898 8:109303018-109303040 TCAAAAAGCCTAAACTGCAGGGG + Intronic
1047425981 8:124747565-124747587 GCCCCCAGGCTAGAGTGCAGTGG + Intergenic
1048324392 8:133428033-133428055 TCCCCCAGGCTAAAGTGCAGAGG + Intergenic
1049195454 8:141313260-141313282 GACCACAGCCTACACAGCGGTGG + Intergenic
1049603755 8:143519810-143519832 GCCCAAAGGCTGCACTGCAGGGG + Intronic
1049748021 8:144271154-144271176 GCCCCCAGCCCAGACTGCACCGG + Intronic
1049948162 9:618246-618268 TCACACAGGCTAAAGTGCAGTGG + Intronic
1050261180 9:3842430-3842452 ACCCCCAGGCTAGACTGCAGTGG - Intronic
1050896062 9:10886974-10886996 TCCAAATGCCTAAACTGCAGTGG + Intergenic
1051744358 9:20280668-20280690 GTCCACATCCTAAACACCAGAGG + Intergenic
1055139775 9:72862929-72862951 CCCCCCAGGCTAAAGTGCAGTGG - Intergenic
1055347730 9:75355283-75355305 TCCAAATGCCTAAACTGCAGTGG - Intergenic
1058698652 9:107582609-107582631 TCACCCAGGCTAAACTGCAGTGG + Intergenic
1060469847 9:123939239-123939261 GACCCAAGCCTAAACTCCAGAGG + Intergenic
1062192463 9:135255029-135255051 GGCCACACCCCACACTGCAGGGG + Intergenic
1062393589 9:136343608-136343630 GCCCACAGCCTAAACTGCAGGGG - Intronic
1185522959 X:755375-755397 TCCCACAGGCTAGAGTGCAGTGG - Intergenic
1185728806 X:2444793-2444815 TCCCACAGGCTAGAGTGCAGTGG - Intronic
1186320409 X:8417917-8417939 TCCCTCAGGCTAAAGTGCAGTGG - Intergenic
1187280009 X:17851052-17851074 GCTTACAGCCAAAACTGCAAGGG - Intronic
1189333434 X:40156329-40156351 GGCCAGAGCCTAAGCTGCACGGG - Intronic
1192737333 X:73861855-73861877 CCCCACAGCCTTAACTGCTGAGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1198018842 X:132638660-132638682 GCCCACAGCATGAACTTCAAGGG - Intronic
1200418045 Y:2934184-2934206 GCCCACAGGCTGCAGTGCAGTGG + Intergenic
1202187808 Y:22206380-22206402 TCACACAGGCTAAAATGCAGTGG - Intergenic
1202203552 Y:22380016-22380038 TCACACAGGCTAAAATGCAGTGG + Intronic