ID: 1062393672

View in Genome Browser
Species Human (GRCh38)
Location 9:136343980-136344002
Sequence CCTGGCACACGGCAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062393672_1062393680 -2 Left 1062393672 9:136343980-136344002 CCAGGCTCCTGCCGTGTGCCAGG No data
Right 1062393680 9:136344001-136344023 GGCACTGCTGGGGCCCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062393672 Original CRISPR CCTGGCACACGGCAGGAGCC TGG (reversed) Intronic