ID: 1062394155

View in Genome Browser
Species Human (GRCh38)
Location 9:136346003-136346025
Sequence TGACCACTGTGGCCACAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062394145_1062394155 15 Left 1062394145 9:136345965-136345987 CCGGATCCTGAATGTGCCGGAGC 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1062394155 9:136346003-136346025 TGACCACTGTGGCCACAGGGTGG No data
1062394146_1062394155 9 Left 1062394146 9:136345971-136345993 CCTGAATGTGCCGGAGCTAACCC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1062394155 9:136346003-136346025 TGACCACTGTGGCCACAGGGTGG No data
1062394143_1062394155 20 Left 1062394143 9:136345960-136345982 CCTGGCCGGATCCTGAATGTGCC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1062394155 9:136346003-136346025 TGACCACTGTGGCCACAGGGTGG No data
1062394147_1062394155 -1 Left 1062394147 9:136345981-136346003 CCGGAGCTAACCCTGATCCCGCT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1062394155 9:136346003-136346025 TGACCACTGTGGCCACAGGGTGG No data
1062394142_1062394155 28 Left 1062394142 9:136345952-136345974 CCTCAGTGCCTGGCCGGATCCTG 0: 1
1: 1
2: 12
3: 119
4: 1210
Right 1062394155 9:136346003-136346025 TGACCACTGTGGCCACAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062394155 Original CRISPR TGACCACTGTGGCCACAGGG TGG Intronic
No off target data available for this crispr