ID: 1062395224

View in Genome Browser
Species Human (GRCh38)
Location 9:136350091-136350113
Sequence GGCTCTTCCCAGCCTTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062395214_1062395224 23 Left 1062395214 9:136350045-136350067 CCTCTCTTTGGGCCTCAGTTTCC No data
Right 1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG No data
1062395222_1062395224 -10 Left 1062395222 9:136350078-136350100 CCAGTTGGGGGCTGGCTCTTCCC No data
Right 1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG No data
1062395213_1062395224 26 Left 1062395213 9:136350042-136350064 CCGCCTCTCTTTGGGCCTCAGTT No data
Right 1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG No data
1062395212_1062395224 27 Left 1062395212 9:136350041-136350063 CCCGCCTCTCTTTGGGCCTCAGT No data
Right 1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG No data
1062395211_1062395224 28 Left 1062395211 9:136350040-136350062 CCCCGCCTCTCTTTGGGCCTCAG No data
Right 1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG No data
1062395219_1062395224 2 Left 1062395219 9:136350066-136350088 CCATCTTGTTCACCAGTTGGGGG No data
Right 1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG No data
1062395215_1062395224 11 Left 1062395215 9:136350057-136350079 CCTCAGTTTCCATCTTGTTCACC No data
Right 1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062395224 Original CRISPR GGCTCTTCCCAGCCTTCAGG TGG Intronic