ID: 1062395568

View in Genome Browser
Species Human (GRCh38)
Location 9:136351303-136351325
Sequence GATCACCGGGACCCCCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 64}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062395568_1062395575 -2 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395575 9:136351324-136351346 TCCCCCAGCCTCCCTGGGCCTGG No data
1062395568_1062395588 16 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395588 9:136351342-136351364 CCTGGAGGGAGGAGCAGGACTGG No data
1062395568_1062395574 -7 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395574 9:136351319-136351341 GGTGATCCCCCAGCCTCCCTGGG No data
1062395568_1062395582 5 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395582 9:136351331-136351353 GCCTCCCTGGGCCTGGAGGGAGG No data
1062395568_1062395586 11 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395586 9:136351337-136351359 CTGGGCCTGGAGGGAGGAGCAGG No data
1062395568_1062395589 17 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395589 9:136351343-136351365 CTGGAGGGAGGAGCAGGACTGGG No data
1062395568_1062395573 -8 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395573 9:136351318-136351340 CGGTGATCCCCCAGCCTCCCTGG No data
1062395568_1062395579 1 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395579 9:136351327-136351349 CCCAGCCTCCCTGGGCCTGGAGG No data
1062395568_1062395581 2 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395581 9:136351328-136351350 CCAGCCTCCCTGGGCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062395568 Original CRISPR GATCACCGGGACCCCCGGGA AGG (reversed) Intronic
901063782 1:6485535-6485557 GAGCGCGGGGACCCCGGGGAGGG + Intronic
903193927 1:21671137-21671159 GATCAAAGGGCCCCCCGGGTTGG - Intergenic
906322540 1:44826225-44826247 GAGCACGGGCACCCCGGGGAGGG - Intronic
908353812 1:63312285-63312307 AATCACCGGGACCCCGGAGGTGG - Intergenic
1074287973 10:112116177-112116199 GATCATCTGCACCCCCGTGACGG + Intergenic
1076784782 10:132744395-132744417 GAATTCCAGGACCCCCGGGAGGG + Intronic
1077186205 11:1236484-1236506 GGTCATCGAGACCCACGGGATGG + Exonic
1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG + Exonic
1093561837 12:20551888-20551910 GCCCACGGGGATCCCCGGGATGG - Intronic
1094374605 12:29776756-29776778 GATCACCTGGCCACCAGGGAAGG + Intronic
1096191663 12:49623689-49623711 GATAGCTGGGACCCCGGGGAGGG + Intronic
1096242511 12:49967037-49967059 GAACCCCGGGAGCCCAGGGAAGG + Intergenic
1101793282 12:107950184-107950206 GATGACAGGGAGCCCCTGGAAGG - Intergenic
1101958535 12:109231113-109231135 GGTCACCGAGACCCAAGGGAAGG + Intronic
1112091907 13:96091142-96091164 GAGCCCGGAGACCCCCGGGAGGG + Exonic
1113709058 13:112452288-112452310 TATCACCAGGGCCCCCGGAATGG + Intergenic
1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG + Intergenic
1122693862 14:103543572-103543594 GGTCACCTGGACCCTGGGGACGG - Intergenic
1129333603 15:74839883-74839905 GTGCACCGGGAGCCCAGGGATGG - Intronic
1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG + Intronic
1132589644 16:721065-721087 GCTCGCCGGAACCCGCGGGAGGG + Exonic
1136383989 16:29911416-29911438 GGACACCAGGACCCCCGGGGAGG - Intronic
1141193090 16:81838888-81838910 GGTCACCGGGACCCGAGGAATGG - Intronic
1141944553 16:87300395-87300417 GATCACCTGAGCCCCAGGGACGG + Intronic
1144169984 17:12650060-12650082 GGTCACTGGGACCACAGGGAGGG + Intergenic
1148128363 17:45248137-45248159 GGGCGCCGGGACCCGCGGGAGGG - Intergenic
1149313845 17:55421375-55421397 GAGCAAAGGGATCCCCGGGAAGG + Intronic
1150207510 17:63420280-63420302 GATGACCGGGAGCCCCTGGCTGG - Exonic
1152684589 17:81687836-81687858 GTCCACCGGGATCCCCGGGCAGG - Intronic
1154266380 18:12883105-12883127 GAACACCGTGCCCCCGGGGAGGG + Intronic
1161556247 19:4944404-4944426 GCCCACGGGGATCCCCGGGATGG - Exonic
1162947107 19:14050792-14050814 GCTCACAGGGACCCCAAGGAAGG - Exonic
1163597019 19:18226221-18226243 GGTCACCGGGACGCCCGGTGTGG - Intronic
1164899996 19:31910220-31910242 GATCACCGGGATGGCAGGGAAGG + Intergenic
1166735233 19:45080005-45080027 GAGCACCGGGGCCACCAGGAGGG + Exonic
935268075 2:101411518-101411540 GATCACAGGGAGTCCCAGGAGGG - Intronic
948708075 2:239807422-239807444 GATCACCAGGACCCCAGGGCTGG + Intergenic
1170366151 20:15600208-15600230 GTGCACCGAGACCCCTGGGATGG + Intronic
1173124811 20:40326890-40326912 GATCTCCGGGGACCCCAGGATGG - Intergenic
1175036281 20:56004228-56004250 GAGCACCGGGATCCCGGGGTAGG - Exonic
1176086748 20:63298907-63298929 GGGCACCGGGGCACCCGGGACGG - Intronic
1176117721 20:63440286-63440308 GCTCACCGGGACCCTTGGGGAGG - Intronic
1181361416 22:22340280-22340302 GATCACAGGGACCACCAAGAAGG + Intergenic
954135415 3:48580034-48580056 GTCCCCCAGGACCCCCGGGACGG - Exonic
954707407 3:52488528-52488550 CATCGCCAAGACCCCCGGGACGG + Exonic
958714629 3:97764683-97764705 AATCGCCAGGACCCCCGGGGAGG + Exonic
962804339 3:138916073-138916095 GATCCCTGGGACCCCCGCCAGGG - Intergenic
966933610 3:184691503-184691525 CAGCACCCGGAGCCCCGGGAAGG + Intergenic
967441781 3:189517198-189517220 GCTCACATGCACCCCCGGGAGGG + Intergenic
968073260 3:195801430-195801452 GAGCCCCGGGGCCCCGGGGAGGG - Intronic
968904849 4:3446408-3446430 GGTTACCGGGGACCCCGGGAAGG - Intronic
969488194 4:7484149-7484171 GATTACCGGGACCGCTGGGATGG - Intronic
969559727 4:7939466-7939488 GACGACCGGGACCCCCGCGCGGG + Exonic
984947118 4:184978339-184978361 GAACACTGGGACCTCGGGGAGGG - Intergenic
985575870 5:673332-673354 GATCACAGGGACCCCCCGAGGGG + Intronic
985691363 5:1314531-1314553 GAGCACCTGGAGCCCCTGGAGGG + Intergenic
985727609 5:1524152-1524174 GAGCACAGGGATCCCCGGCAGGG + Intergenic
1002634425 5:180600088-180600110 GATCAGAGGGACCCCCGGGAGGG - Intergenic
1006876705 6:37303804-37303826 GGTCAGGGGGACCCCAGGGAAGG - Intronic
1015786124 6:136922658-136922680 GAGCACCGCGACCCCCGCGAAGG - Exonic
1024023599 7:45392136-45392158 TATCTCCTGGACCTCCGGGATGG - Intergenic
1029605661 7:101598177-101598199 TATCTCTGGGCCCCCCGGGAAGG + Intergenic
1046868192 8:119174501-119174523 GATCACCTGAGCCCCAGGGAGGG - Intronic
1048002620 8:130391893-130391915 GATCACCAGAACCCCTGGAAAGG + Intronic
1049807837 8:144548881-144548903 GCTCACCTGGACCACTGGGACGG - Intronic
1058144798 9:101399201-101399223 GACAACCGGGATCCCCGGGGGGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061664747 9:132154009-132154031 ACTCACCGGGACCTCCAGGAGGG + Intergenic
1061682467 9:132249864-132249886 GCCCACCGGGAGCTCCGGGAGGG - Intergenic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic