ID: 1062395581

View in Genome Browser
Species Human (GRCh38)
Location 9:136351328-136351350
Sequence CCAGCCTCCCTGGGCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062395569_1062395581 -2 Left 1062395569 9:136351307-136351329 CCCGGGGGTCCCGGTGATCCCCC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1062395581 9:136351328-136351350 CCAGCCTCCCTGGGCCTGGAGGG No data
1062395568_1062395581 2 Left 1062395568 9:136351303-136351325 CCTTCCCGGGGGTCCCGGTGATC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1062395581 9:136351328-136351350 CCAGCCTCCCTGGGCCTGGAGGG No data
1062395560_1062395581 23 Left 1062395560 9:136351282-136351304 CCCAGGGAGCACCTGGTCAGGCC 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1062395581 9:136351328-136351350 CCAGCCTCCCTGGGCCTGGAGGG No data
1062395566_1062395581 12 Left 1062395566 9:136351293-136351315 CCTGGTCAGGCCTTCCCGGGGGT 0: 1
1: 0
2: 1
3: 15
4: 132
Right 1062395581 9:136351328-136351350 CCAGCCTCCCTGGGCCTGGAGGG No data
1062395570_1062395581 -3 Left 1062395570 9:136351308-136351330 CCGGGGGTCCCGGTGATCCCCCA 0: 1
1: 0
2: 2
3: 9
4: 159
Right 1062395581 9:136351328-136351350 CCAGCCTCCCTGGGCCTGGAGGG No data
1062395561_1062395581 22 Left 1062395561 9:136351283-136351305 CCAGGGAGCACCTGGTCAGGCCT 0: 1
1: 0
2: 1
3: 33
4: 260
Right 1062395581 9:136351328-136351350 CCAGCCTCCCTGGGCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062395581 Original CRISPR CCAGCCTCCCTGGGCCTGGA GGG Intronic
No off target data available for this crispr