ID: 1062396087

View in Genome Browser
Species Human (GRCh38)
Location 9:136353451-136353473
Sequence CCCAGGGTCCTGCTTCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062396070_1062396087 30 Left 1062396070 9:136353398-136353420 CCCACTGGATATGTTCTACTGGG 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1062396087 9:136353451-136353473 CCCAGGGTCCTGCTTCTGAGGGG No data
1062396072_1062396087 29 Left 1062396072 9:136353399-136353421 CCACTGGATATGTTCTACTGGGA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1062396087 9:136353451-136353473 CCCAGGGTCCTGCTTCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062396087 Original CRISPR CCCAGGGTCCTGCTTCTGAG GGG Intronic
No off target data available for this crispr