ID: 1062397592

View in Genome Browser
Species Human (GRCh38)
Location 9:136358682-136358704
Sequence CCAGGACGAAGCTGGAGGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062397592_1062397606 15 Left 1062397592 9:136358682-136358704 CCACCCCTCCAGCTTCGTCCTGG 0: 1
1: 0
2: 0
3: 28
4: 361
Right 1062397606 9:136358720-136358742 AAGCCTGTCTCCCCACTCCCCGG 0: 1
1: 0
2: 6
3: 39
4: 319
1062397592_1062397608 22 Left 1062397592 9:136358682-136358704 CCACCCCTCCAGCTTCGTCCTGG 0: 1
1: 0
2: 0
3: 28
4: 361
Right 1062397608 9:136358727-136358749 TCTCCCCACTCCCCGGCCAGAGG 0: 1
1: 0
2: 1
3: 40
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062397592 Original CRISPR CCAGGACGAAGCTGGAGGGG TGG (reversed) Exonic