ID: 1062400832

View in Genome Browser
Species Human (GRCh38)
Location 9:136371916-136371938
Sequence GGTGCTCAGCGACCCCAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062400832_1062400833 -7 Left 1062400832 9:136371916-136371938 CCAGGTTGGGGTCGCTGAGCACC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1062400833 9:136371932-136371954 GAGCACCTGCTCCTCATCATCGG 0: 1
1: 0
2: 2
3: 16
4: 164
1062400832_1062400839 19 Left 1062400832 9:136371916-136371938 CCAGGTTGGGGTCGCTGAGCACC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1062400839 9:136371958-136371980 TCAGGACCTTGCACTGCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 121
1062400832_1062400835 -5 Left 1062400832 9:136371916-136371938 CCAGGTTGGGGTCGCTGAGCACC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1062400835 9:136371934-136371956 GCACCTGCTCCTCATCATCGGGG 0: 1
1: 0
2: 2
3: 8
4: 117
1062400832_1062400840 24 Left 1062400832 9:136371916-136371938 CCAGGTTGGGGTCGCTGAGCACC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1062400840 9:136371963-136371985 ACCTTGCACTGCCGCAGGTAAGG 0: 1
1: 0
2: 1
3: 9
4: 70
1062400832_1062400837 1 Left 1062400832 9:136371916-136371938 CCAGGTTGGGGTCGCTGAGCACC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1062400837 9:136371940-136371962 GCTCCTCATCATCGGGGTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
1062400832_1062400834 -6 Left 1062400832 9:136371916-136371938 CCAGGTTGGGGTCGCTGAGCACC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1062400834 9:136371933-136371955 AGCACCTGCTCCTCATCATCGGG 0: 1
1: 0
2: 1
3: 11
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062400832 Original CRISPR GGTGCTCAGCGACCCCAACC TGG (reversed) Exonic
900801883 1:4742275-4742297 TGTTCTCAGCGACTCCAATCAGG - Intronic
902530228 1:17086155-17086177 GGTGGTCAGCAAACCCCACCTGG + Intronic
902777308 1:18682973-18682995 GGTGAGCAGGGACCCCAGCCAGG - Intronic
903179441 1:21597916-21597938 GGTGCTGAGGGAGCCCCACCCGG - Intronic
904214802 1:28910896-28910918 GGTCCTTAGGGACCCCATCCTGG + Intronic
904253343 1:29239491-29239513 GGAGCTCAGCGTCCCCACCTCGG - Intronic
905971891 1:42147889-42147911 GGTGCTCAGAGACCTGAAACTGG - Intergenic
912278059 1:108281518-108281540 GGCTCCCAGTGACCCCAACCAGG - Intergenic
912290167 1:108412839-108412861 GGCTCCCAGTGACCCCAACCAGG + Intronic
913527059 1:119703631-119703653 GCTGCTCAGGCACCCCAGCCAGG - Intronic
916498250 1:165364757-165364779 AGGGCTCAGCCACCCCATCCTGG + Intergenic
920278790 1:204828386-204828408 GGTGCTCAGCGAACGGAAACGGG + Intergenic
922575156 1:226656238-226656260 GGCGCTCAGAGACCCCCAGCAGG + Intronic
922803546 1:228374658-228374680 GGTCCTCAGCCACCACCACCAGG - Exonic
1067836825 10:49646581-49646603 GGAGCTCAGCGACACCCACAGGG + Exonic
1070079161 10:73168395-73168417 ACTGCTCAGCCACCCCAGCCGGG + Intronic
1071508394 10:86246463-86246485 GGGTCTCAGCCACCACAACCCGG + Intronic
1071772365 10:88743764-88743786 GGTGCTCAGCAACCCCGTTCAGG - Intronic
1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG + Intergenic
1074801553 10:117005411-117005433 GGTGCGGAGCGACCCCACGCAGG - Exonic
1075587172 10:123666368-123666390 GGCGCTCAGGGTCCGCAACCCGG - Exonic
1075655037 10:124155828-124155850 GGTGTCCAGAGACCCCCACCAGG + Intergenic
1076705265 10:132297968-132297990 GGTGCTCTGCGGCAGCAACCCGG + Intronic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG + Intergenic
1081730270 11:45367130-45367152 CGTGCTCAGAGAGTCCAACCAGG + Intergenic
1083624934 11:64067541-64067563 GGGGCTCAGGGACCCAAAGCAGG + Intronic
1083684766 11:64369595-64369617 GGTGCACCGCGACCTCAAGCCGG + Exonic
1083964682 11:66036088-66036110 GGTGCTCTGCCAACACAACCGGG - Intergenic
1084177919 11:67433141-67433163 GGTGCGCAGTGGCCACAACCGGG + Exonic
1084688491 11:70711182-70711204 GGAGCTCAGCAATCACAACCAGG - Intronic
1085757114 11:79211005-79211027 GGTAGGCACCGACCCCAACCTGG + Intronic
1089749004 11:120637003-120637025 GGTCCTCAGAGACCCGAAGCAGG - Intronic
1090333558 11:125948450-125948472 GTGGCTCAGTGACCCCCACCAGG - Intergenic
1091741784 12:2964417-2964439 GTTGTCCAGCGACCCCAGCCTGG - Intronic
1093748894 12:22776201-22776223 GGTGCTCGAGGACCCCAAACTGG + Intergenic
1095259579 12:40082885-40082907 GGTGCTCAGCAACTCCATGCAGG + Intronic
1103738786 12:123077867-123077889 GCTGCTGCGCGACCCCAGCCTGG - Intronic
1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG + Intronic
1108424980 13:50290557-50290579 GGTGATCAGGGACACCAGCCAGG - Intronic
1111962659 13:94828150-94828172 GGAGCTCTGCGACCTCTACCAGG - Intergenic
1114969395 14:28006206-28006228 GGTGCTCAGCAACCCCATACAGG + Intergenic
1118473451 14:66095323-66095345 TGTGCTCAGACACCCCAAGCAGG - Intergenic
1119319114 14:73719015-73719037 GGTTCTGAGCAACCCCCACCCGG - Exonic
1119381728 14:74233535-74233557 GGTCCTCAGAGACACCTACCTGG + Intergenic
1119767499 14:77199622-77199644 GGGGCTCAGAGACCACAGCCCGG - Intronic
1123936373 15:25196077-25196099 GACGCTCAGGGACCCCACCCCGG - Intergenic
1124622305 15:31280634-31280656 GGGGCTCAGGCACCCCACCCAGG - Intergenic
1129600288 15:76994758-76994780 GCTGCTCTGGGACCCAAACCAGG - Intronic
1132892429 16:2210793-2210815 TGTGCTGAGCGCCCCAAACCTGG - Exonic
1137670442 16:50275281-50275303 TGTGCGCAGCTAGCCCAACCTGG + Intronic
1139373205 16:66480870-66480892 AGGGCTCACCCACCCCAACCCGG + Exonic
1140583953 16:76265570-76265592 TGTTCTCAGCAGCCCCAACCAGG - Intergenic
1141389126 16:83649705-83649727 CGTGTTCAGCATCCCCAACCTGG - Intronic
1141708322 16:85682490-85682512 GGGGCTAAGCCACCCCAGCCTGG + Intronic
1147140265 17:38456681-38456703 GGTGCTCACGGAGCCCAACTGGG - Intronic
1147165242 17:38589660-38589682 GGTGCTCAGCGCCTCCACCAGGG + Intronic
1151791890 17:76311148-76311170 GGCGCTCAGCTTCCCTAACCAGG + Exonic
1152038839 17:77890379-77890401 GGTGCTTAGTGTCCCCCACCAGG + Intergenic
1154363120 18:13681842-13681864 GATGCTCATCCACCCCAACCAGG - Exonic
1160832455 19:1110140-1110162 GGTGCTGGGTGACCCCAAGCAGG + Intronic
1160843869 19:1158198-1158220 GGTGCTCAGGGACCCCCAGGGGG - Intronic
1161241222 19:3224964-3224986 GGTGCTCAAAGACCCCTACACGG + Exonic
1162464627 19:10832399-10832421 GGGGCTCAGGGACACCAGCCAGG - Intronic
1166051896 19:40265530-40265552 TGTCCCCAGCGACCCCAATCTGG + Intronic
1166067953 19:40371017-40371039 GAAGCTCAGAGACCCCAACCTGG + Intronic
1168565046 19:57415619-57415641 GATGCCCAGCAACCCCATCCAGG - Intronic
934043362 2:88148084-88148106 GGTGCTCAGCCACACCACTCAGG + Intergenic
936692775 2:114912667-114912689 GGTGCTCAGCAACCCCTTGCAGG - Intronic
937533121 2:122854131-122854153 GGTGTTCAGAGATCCCAGCCTGG + Intergenic
941054868 2:160776486-160776508 GTTGCTCAGCAACCCCATGCAGG - Intergenic
947433040 2:230047158-230047180 TGTGTCCAGAGACCCCAACCTGG + Intronic
1173982596 20:47236410-47236432 GGTGCTCATGGACCCCGAGCTGG + Exonic
1174392556 20:50226844-50226866 CGTGCTCAGTGACCTCAGCCTGG - Intergenic
1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG + Intergenic
1177567842 21:22847054-22847076 GGTGCTCAGAGAACCCTCCCAGG + Intergenic
1178916961 21:36710293-36710315 GGTGCTTAGCGCCCCGAGCCCGG + Intronic
1181489225 22:23251265-23251287 CCTGCTGAGCGACCCCAACCCGG - Intronic
1181498643 22:23302674-23302696 GGCGCTCTGCGACACCAGCCTGG - Intronic
1181638915 22:24186842-24186864 GGTCCTCACCCATCCCAACCAGG - Intronic
1182261163 22:29073586-29073608 GTCCCTCAGCGACCCCAACCAGG + Intronic
1182304151 22:29356359-29356381 GGTCCTCAGGGGCTCCAACCAGG - Intronic
1183034085 22:35127584-35127606 TGGGCTAAGCGACCCCCACCAGG - Intergenic
1183538988 22:38418819-38418841 GGTGCTCAGGGACCCCAGGATGG - Intergenic
1184553778 22:45220923-45220945 TGTGCTAAGCGTCCCCATCCTGG + Intronic
949661353 3:6283118-6283140 GGTGCTCAGCGACCCCGTGCAGG - Intergenic
952977453 3:38708297-38708319 GTTTCTCAGTGACCCCAGCCTGG + Intronic
953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG + Intronic
953385118 3:42501968-42501990 GGTGCTGAGCGCGCCCCACCAGG + Intronic
954223021 3:49166106-49166128 CGCGCCCAGCGACCCCACCCTGG - Intronic
957154250 3:76527506-76527528 GCTCCTCAGTGACCCAAACCAGG + Intronic
962375140 3:134852867-134852889 AGGGCTCAGATACCCCAACCTGG - Intronic
968008227 3:195257181-195257203 GGTGCCCAGCCATCCCACCCCGG + Intronic
968235436 3:197028186-197028208 GCTTCTCAGCTACCCCCACCTGG + Intronic
982460752 4:155666928-155666950 GGAGCTTAGAGACCCCAGCCGGG + Intronic
985779362 5:1862016-1862038 GGCTCTCAGCGGCCCCCACCAGG - Intergenic
991444121 5:66681484-66681506 GGTGCTGAGTCACCCCCACCAGG - Intronic
998230983 5:140361263-140361285 TGGGCTCAGCGACTCCACCCTGG - Exonic
1002527851 5:179824892-179824914 GGTGCTCAGCAACCCCACAGAGG - Intronic
1002599678 5:180347067-180347089 GGCGCTCAGCATCCCCCACCTGG - Intronic
1006962996 6:37952774-37952796 GGTGCTCAGCAGCCCCATGCAGG + Intronic
1010655173 6:78503316-78503338 GGTGCTCAGCAACCACATGCAGG + Intergenic
1014841517 6:126225388-126225410 AGTGCTCAGCAACCCCATGCAGG + Intergenic
1018170796 6:161141520-161141542 GGTGCCCTGTGGCCCCAACCTGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1020715686 7:11673147-11673169 GGTGCTCAGTGACTCCAGGCAGG - Intronic
1021477554 7:21079906-21079928 TGTGCTCAGCAATCCCAACCTGG + Intergenic
1022114156 7:27248153-27248175 GTTGCTCAGAGACCACAACCTGG - Intergenic
1022950867 7:35336753-35336775 GGTGCTCAGCCACTCCTAGCTGG - Intergenic
1025033256 7:55573810-55573832 GGAGTTCACCAACCCCAACCTGG + Intergenic
1025094533 7:56087150-56087172 GGTGCTCAAAGACGTCAACCTGG + Intronic
1026829742 7:73603369-73603391 GGAGCCCAGCCACCCCCACCTGG - Intronic
1033260766 7:139842333-139842355 GGTGCTCAGCGATGCCTTCCCGG + Intronic
1034465333 7:151224824-151224846 GCTGCTCAGTGACACCAAACTGG - Exonic
1035570074 8:666932-666954 GGTCCTCAGCAACCCCAACCTGG + Intronic
1036054685 8:5238701-5238723 GGTGCTCAGCAACCCCATTCAGG - Intergenic
1039554808 8:38468143-38468165 GGTGCTCGGCGCCTCCAGCCCGG + Intronic
1039897388 8:41725775-41725797 GCTGCAGAACGACCCCAACCCGG - Exonic
1049412200 8:142478373-142478395 GGTGCCCCCCGACCCCAGCCTGG - Intronic
1050063007 9:1730066-1730088 GGCCCTCTGGGACCCCAACCAGG + Intergenic
1051102404 9:13535956-13535978 GGTGCTCAGCAACCCTATGCAGG + Intergenic
1057517866 9:95737159-95737181 GGTTCTCAGGGACCTCAGCCAGG + Intergenic
1057705077 9:97390219-97390241 GAGGCTCAGAGACCCCACCCAGG + Intergenic
1059657659 9:116370598-116370620 TGTGCTCAGTGACAGCAACCTGG - Intronic
1061453399 9:130681140-130681162 GGCCCTCAGCGCCCCCAGCCCGG - Intronic
1061793858 9:133072130-133072152 GGTGTTTAGAGACCCCAATCTGG + Intronic
1061933423 9:133844917-133844939 GTTCCTCAGCAGCCCCAACCAGG + Intronic
1062400832 9:136371916-136371938 GGTGCTCAGCGACCCCAACCTGG - Exonic
1186409010 X:9329389-9329411 TGTGCCCAGCGCCCCCCACCTGG - Intergenic
1187614786 X:20981306-20981328 GGTGCTCAGCAACCCCATACAGG - Intergenic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1201955094 Y:19614537-19614559 GTTGTTCAGTGACCCCAACTTGG + Intergenic