ID: 1062401575

View in Genome Browser
Species Human (GRCh38)
Location 9:136375110-136375132
Sequence CGCTGCTGCCACAGAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062401564_1062401575 18 Left 1062401564 9:136375069-136375091 CCAGTGAAGGATCGAAGCCCAGA No data
Right 1062401575 9:136375110-136375132 CGCTGCTGCCACAGAGACAAAGG No data
1062401569_1062401575 1 Left 1062401569 9:136375086-136375108 CCCAGATAGCCAAGGGCCTGGGG No data
Right 1062401575 9:136375110-136375132 CGCTGCTGCCACAGAGACAAAGG No data
1062401571_1062401575 0 Left 1062401571 9:136375087-136375109 CCAGATAGCCAAGGGCCTGGGGG No data
Right 1062401575 9:136375110-136375132 CGCTGCTGCCACAGAGACAAAGG No data
1062401563_1062401575 29 Left 1062401563 9:136375058-136375080 CCACAGTGGCTCCAGTGAAGGAT No data
Right 1062401575 9:136375110-136375132 CGCTGCTGCCACAGAGACAAAGG No data
1062401573_1062401575 -8 Left 1062401573 9:136375095-136375117 CCAAGGGCCTGGGGGCGCTGCTG No data
Right 1062401575 9:136375110-136375132 CGCTGCTGCCACAGAGACAAAGG No data
1062401562_1062401575 30 Left 1062401562 9:136375057-136375079 CCCACAGTGGCTCCAGTGAAGGA No data
Right 1062401575 9:136375110-136375132 CGCTGCTGCCACAGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062401575 Original CRISPR CGCTGCTGCCACAGAGACAA AGG Intergenic
No off target data available for this crispr