ID: 1062401647

View in Genome Browser
Species Human (GRCh38)
Location 9:136375397-136375419
Sequence CGGGGTACGGGAGGCCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062401635_1062401647 24 Left 1062401635 9:136375350-136375372 CCAGGAAATGGGCGAAAGAAAGC No data
Right 1062401647 9:136375397-136375419 CGGGGTACGGGAGGCCTTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 123
1062401639_1062401647 2 Left 1062401639 9:136375372-136375394 CCTGCTTCTCTGACAGGAGGGCA 0: 1
1: 0
2: 1
3: 20
4: 234
Right 1062401647 9:136375397-136375419 CGGGGTACGGGAGGCCTTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062401647 Original CRISPR CGGGGTACGGGAGGCCTTCC AGG Intergenic
900717337 1:4153390-4153412 CGGGGTAGGGCAGGACATCCAGG - Intergenic
901052296 1:6431266-6431288 GGGGGTAGGGGAGGCTTTCGGGG - Intronic
912568848 1:110607328-110607350 CGGGGTGCGGGCGGCCAGCCGGG + Exonic
915266136 1:154719274-154719296 CGGGGAAAGGGAGGCCTGGCCGG + Intronic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
921350720 1:214231563-214231585 GGTGGTACGGGAAGGCTTCCTGG - Intergenic
923538844 1:234873797-234873819 TGGGGTATAGGAGGGCTTCCTGG - Intergenic
1063464990 10:6237179-6237201 CGGGAGACGGGAGGCCTTTTTGG - Intergenic
1065131741 10:22628658-22628680 CAGGGGAAGGCAGGCCTTCCAGG + Intronic
1066370208 10:34814231-34814253 TGGGGTCGGGGAGGCGTTCCCGG - Intronic
1070594340 10:77821684-77821706 TGGGGTTGGGGAGGCCTCCCTGG - Exonic
1072740359 10:97905433-97905455 CGTGGTCAGGGAGGGCTTCCCGG - Intronic
1075666623 10:124235448-124235470 TGGGGTTAGGGTGGCCTTCCTGG - Intergenic
1076706934 10:132307461-132307483 CGGTGTCCGGGACGGCTTCCCGG - Intronic
1077005890 11:355974-355996 CGGCGCCCGGGAGGCCTCCCAGG + Intergenic
1077253994 11:1572538-1572560 CCGGGGCCGGGAGGGCTTCCTGG - Intergenic
1078009940 11:7565244-7565266 TGGGGTCCAGGTGGCCTTCCAGG + Intronic
1081164047 11:39786356-39786378 AGGGGAAAGGGGGGCCTTCCTGG + Intergenic
1081853654 11:46290697-46290719 CAGTGTACAGGAGGCCTCCCAGG + Intronic
1083573052 11:63769867-63769889 CAGGGTGCGGGAGGCCTGCAGGG + Intergenic
1084195097 11:67520053-67520075 GGAGCTACGGGACGCCTTCCGGG - Exonic
1084327641 11:68411037-68411059 CAGGGCAGGGGAGGCCTTGCGGG - Intronic
1089813685 11:121153077-121153099 CGAGGTATGGGAGGCCAGCCCGG + Exonic
1092171711 12:6377502-6377524 GGGAGTGAGGGAGGCCTTCCCGG - Intronic
1098641203 12:72839862-72839884 CAGGGAACGGGAGGCCTGCCTGG - Intergenic
1101439617 12:104693689-104693711 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1102007328 12:109597019-109597041 AGGGGTAGGGGAAGGCTTCCTGG - Exonic
1102603896 12:114054044-114054066 TGGGGCATGGGAGGGCTTCCTGG - Intergenic
1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG + Intronic
1111119160 13:83823632-83823654 AGGGGTGGGGGAGGCTTTCCAGG - Intergenic
1118703620 14:68459964-68459986 TGGTGTACAGGAAGCCTTCCTGG + Intronic
1121138398 14:91519384-91519406 CGGAGTCCGGGAGGCCTGCTTGG + Intergenic
1122296942 14:100711185-100711207 AGGGGAGGGGGAGGCCTTCCCGG - Intergenic
1122463234 14:101913074-101913096 CAGGGTCCGGGAGGGTTTCCTGG + Intronic
1123018031 14:105384774-105384796 CGGGGTACGGGAGGCCTGGGCGG + Intronic
1127796770 15:62445096-62445118 AGGGGTCAGGGAGGCCTTACTGG + Intronic
1128729916 15:70014138-70014160 AGGGGAACTGGAGGCCTTCCTGG - Intergenic
1129177174 15:73848401-73848423 GGGAGTCAGGGAGGCCTTCCTGG - Intergenic
1131114103 15:89783696-89783718 TGGGGGATGGGGGGCCTTCCTGG + Intergenic
1132536477 16:483886-483908 CGGGGGACGGGCGGGCTTCCAGG - Intronic
1132851359 16:2026464-2026486 GGGGGTCCGGAAGGGCTTCCCGG + Intronic
1133784477 16:8963701-8963723 CGGCGGACGGGAGGCCTGGCCGG + Intronic
1135988766 16:27204172-27204194 CGGGGTACGGGGGACCCTCTGGG + Exonic
1137724988 16:50651003-50651025 GGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1138420721 16:56897432-56897454 TGGAGCACGGGAGGCCATCCTGG - Intronic
1143105172 17:4526172-4526194 TGGGGTCAGGGAGGGCTTCCTGG + Intronic
1143252313 17:5532775-5532797 TGGGGTGCGGGAGGCCAGCCTGG + Intronic
1143575338 17:7789273-7789295 CTGGGTAGGGGAGGCTTCCCGGG + Intronic
1146656643 17:34638594-34638616 CGGGGGACGGGAGGCGGGCCCGG - Exonic
1147996642 17:44363403-44363425 CGGGGAGAGGGAGGCCGTCCGGG - Intronic
1152466948 17:80471818-80471840 CGGGGTCTGGGAGGCCTACCAGG - Exonic
1160307495 18:77753707-77753729 AGGGGTGTGGGATGCCTTCCTGG + Intergenic
1160827793 19:1088799-1088821 CGGGGTGCGGGAGGCCTGGCAGG + Intronic
1160860231 19:1234518-1234540 CGGGGGACGGGAGGCAGCCCCGG - Intronic
1160953756 19:1680024-1680046 TGGGGTCAGGGAGGGCTTCCTGG + Intergenic
1161421314 19:4177224-4177246 AGGAGTCCGGGAAGCCTTCCTGG - Intronic
1161456978 19:4374538-4374560 CGGGCTGGTGGAGGCCTTCCGGG - Intronic
1161502403 19:4623653-4623675 GGCGGTCCGGGAGGGCTTCCTGG - Intergenic
1161513776 19:4685390-4685412 GGGGGAAGGGGAGGCCATCCAGG + Intronic
1162533357 19:11248571-11248593 AGGGGTCAGGGAGGACTTCCTGG - Intronic
1162577400 19:11506944-11506966 GGGGGGTCAGGAGGCCTTCCTGG - Intronic
1163905386 19:20147896-20147918 TGGGGTACAGGAGGCCCTGCTGG + Intergenic
1166663089 19:44660008-44660030 GGGGGTCAGGGAGGGCTTCCTGG - Intronic
1166784422 19:45359140-45359162 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1166795767 19:45424453-45424475 CGGAGTCCGGAAGGGCTTCCTGG + Intronic
1166981187 19:46633257-46633279 GGAGGTAAGGGAGGGCTTCCTGG - Intergenic
1167124331 19:47539018-47539040 GGAGGTAAGGGAGGGCTTCCTGG - Intronic
1167794869 19:51702683-51702705 CGGGGTAAGGGAGGCGGTCGGGG + Intergenic
926159468 2:10477485-10477507 TGGGGAAAGGGAAGCCTTCCTGG + Intergenic
927613656 2:24566895-24566917 AGGGGCATGGGGGGCCTTCCTGG + Intronic
930800408 2:55437878-55437900 AGGGGGAAGGGAGGTCTTCCTGG - Intergenic
932522341 2:72427381-72427403 GGGGGCAGTGGAGGCCTTCCTGG - Intronic
936954831 2:118013610-118013632 CGGGGTGGGGGAGCCCGTCCCGG + Intronic
937991591 2:127665069-127665091 CGGGGTACATGGTGCCTTCCTGG - Intronic
942053577 2:172162790-172162812 GGGGGAAAGGGAGGCCTTCCTGG + Intergenic
943023162 2:182599144-182599166 GAGGGTAGGGGGGGCCTTCCTGG - Intergenic
945933038 2:215875034-215875056 TGGAGTAAGGGAGGCCCTCCTGG - Intergenic
948696506 2:239735646-239735668 GGGGGTTCTGGAGGCCTTGCAGG + Intergenic
1170174563 20:13454389-13454411 CAGGGGAAGGGAGGCCATCCAGG - Intronic
1175278708 20:57788461-57788483 CAGGGGACTGAAGGCCTTCCAGG - Intergenic
1176185078 20:63773861-63773883 CGGGGTACTGGGGCCTTTCCAGG - Intronic
1178315135 21:31560631-31560653 CAGGGTACAGGAGGCTTCCCGGG - Intergenic
1181270151 22:21653820-21653842 GGGGGTAAGGCAGGCCTTTCAGG + Intronic
1181474101 22:23158094-23158116 CAGGGTCTGGGAGCCCTTCCAGG - Intronic
1182287267 22:29255753-29255775 GGGGGTCAGGGAGGTCTTCCTGG + Intronic
1184263398 22:43332738-43332760 TGAGGTTCTGGAGGCCTTCCTGG + Intronic
1184410923 22:44325928-44325950 AGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1184423609 22:44396145-44396167 GGTGGTCCGGGAGGCCCTCCAGG + Intergenic
1184797167 22:46738908-46738930 TGGGGTCAAGGAGGCCTTCCTGG - Intergenic
950127398 3:10518443-10518465 AGGGATAGGGGAGGCATTCCTGG + Intronic
951520423 3:23606130-23606152 TGGGGTCAGGGAAGCCTTCCTGG + Intergenic
953926649 3:46985977-46985999 CGGGGTACGGGAGTCCCTCAGGG - Intronic
958892212 3:99794985-99795007 CGGGGCATGGGAGGTGTTCCTGG + Exonic
961825764 3:129598270-129598292 AGGAGTGCGGGAGGGCTTCCTGG - Intronic
962626312 3:137229112-137229134 AGGGGTCAGGGAGGGCTTCCTGG + Intergenic
962814778 3:138988089-138988111 CGGGGTCAGGGAAGGCTTCCTGG + Intergenic
962920810 3:139949075-139949097 CAGCGTGGGGGAGGCCTTCCAGG - Intronic
963805043 3:149714355-149714377 CGGGGCAAGGGTGGCCTTCCTGG - Intronic
965534714 3:169812477-169812499 CGGCGCACGGGCGGCCTCCCGGG + Exonic
967115587 3:186334548-186334570 TGGGGTAGAGGAGGCCATCCAGG - Intronic
967894843 3:194387467-194387489 AGGGGTGCAGGAGGCCTTCCAGG - Intergenic
968707857 4:2091421-2091443 GAGGGTCTGGGAGGCCTTCCAGG + Intronic
968962686 4:3753349-3753371 AGGGGTGCAGGAGGGCTTCCTGG + Intergenic
969399545 4:6944844-6944866 CGGGGCAGAGGTGGCCTTCCGGG + Intronic
969677135 4:8620340-8620362 CAGGCTACGGGACCCCTTCCTGG - Intergenic
969678088 4:8625979-8626001 CAGGCTACGGGACCCCTTCCTGG - Intergenic
969679043 4:8631616-8631638 CAGGCTACGGGACCCCTTCCTGG - Intergenic
977487406 4:97665984-97666006 GGGGGTAGGGGAGGCCTTCCTGG + Intronic
983680140 4:170343867-170343889 CGGGGGAGGGGAGCCCTTGCAGG - Intergenic
985973223 5:3393511-3393533 GGGGGTGGGGGAGGCCCTCCTGG + Intergenic
989167538 5:38446099-38446121 AGCGGTGGGGGAGGCCTTCCCGG - Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
991291316 5:65035868-65035890 CCGGGTCCGGGAGGCTGTCCCGG + Intergenic
992955274 5:81901740-81901762 CGGGGTCCTGGAGGGCTCCCAGG + Intergenic
1002394557 5:178942594-178942616 TGGGGTACTGGAGGCCTCCCAGG + Intronic
1002434026 5:179220443-179220465 TGAGGTACCTGAGGCCTTCCGGG - Intronic
1003355845 6:5369065-5369087 CGCGGGACTGGATGCCTTCCTGG + Exonic
1008524440 6:52394053-52394075 TAGGATACAGGAGGCCTTCCTGG - Intronic
1016843227 6:148544715-148544737 CCGGGCACAGGAGACCTTCCTGG - Exonic
1019268070 7:130027-130049 CGGGGAAGCGGAGGCGTTCCAGG - Intergenic
1019568211 7:1695199-1695221 CAGGGTCCTGGTGGCCTTCCTGG - Intronic
1023700127 7:42883928-42883950 TGGGGGCAGGGAGGCCTTCCTGG + Intergenic
1027995705 7:85423549-85423571 CGGGATACGGGTGGCTTCCCAGG - Intergenic
1028596025 7:92547024-92547046 GGGGGGAAGGGGGGCCTTCCCGG - Intergenic
1035447329 7:158951866-158951888 CGGGGGACGTGAGGGCTTCCAGG + Intronic
1035616926 8:1008995-1009017 AGGGGTACTGGAGGCCTGCGAGG - Intergenic
1037150151 8:15626609-15626631 AGGGGTAAGGGGGGCCTTCCTGG - Intronic
1037833219 8:22201206-22201228 AGGGGTCCGGGAGGCCTGGCAGG - Intronic
1041609353 8:59826573-59826595 GGGGGTACAGGTGGGCTTCCAGG - Intergenic
1050992298 9:12169851-12169873 AGGGGTATGGGACGGCTTCCTGG + Intergenic
1060269047 9:122128367-122128389 CGGGTTGCGGGAGGCCTCCGTGG - Intergenic
1060812791 9:126619375-126619397 GGGCCTATGGGAGGCCTTCCAGG - Intronic
1060933507 9:127503310-127503332 TGGGTGAGGGGAGGCCTTCCTGG + Exonic
1061513082 9:131072628-131072650 AGGGGCTCGGGAAGCCTTCCTGG + Exonic
1062401647 9:136375397-136375419 CGGGGTACGGGAGGCCTTCCAGG + Intergenic
1192147675 X:68693054-68693076 CGTGGCAGGGGAGGGCTTCCAGG - Intronic
1194106785 X:89779424-89779446 CAGTGTACGCGAGTCCTTCCTGG - Intergenic
1196885879 X:120244990-120245012 CGGGGAACGGGCGGCTTTGCTGG + Intergenic
1200458747 Y:3427289-3427311 CAGTGTACGCGAGTCCTTCCTGG - Intergenic