ID: 1062403161

View in Genome Browser
Species Human (GRCh38)
Location 9:136381331-136381353
Sequence CAGGGTAAACACAGGGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062403154_1062403161 -1 Left 1062403154 9:136381309-136381331 CCAAGTAGCTTACCTGGGTAAAC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 194
1062403153_1062403161 0 Left 1062403153 9:136381308-136381330 CCCAAGTAGCTTACCTGGGTAAA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062403161 Original CRISPR CAGGGTAAACACAGGGGTGC TGG Exonic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
900685678 1:3946214-3946236 GAGGATCCACACAGGGGTGCAGG - Intergenic
900975477 1:6013639-6013661 TAGGGGGAAGACAGGGGTGCAGG - Intronic
901464572 1:9413115-9413137 CAGGGTGAGGACAGGGCTGCGGG - Intergenic
901783560 1:11610065-11610087 CAGGTTAAACACATGGATGTTGG - Intergenic
904459509 1:30667824-30667846 CAGGATTAACACAGGGTTGCTGG - Intergenic
905733432 1:40311457-40311479 CGGGGCTAACACAGGGGGGCGGG - Intronic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
910356543 1:86363080-86363102 CAGGATAATGACAGTGGTGCTGG + Intronic
911182078 1:94870222-94870244 CAGCATAAACACATGGTTGCTGG - Intronic
912629720 1:111236164-111236186 CAGGGGAACCGCAGGGGTACTGG + Intronic
913246938 1:116878530-116878552 CAGGGTAAAGAGAGGAGCGCTGG + Intergenic
914805533 1:150988477-150988499 CAGGGCTTACACAGGGGTGGAGG + Intronic
918176795 1:182053752-182053774 CAGGGTAAAGCCAGGTGTGGTGG - Intergenic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG + Intronic
1063424615 10:5941603-5941625 GACGGAAAACACAGGTGTGCCGG + Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064463124 10:15554157-15554179 CCAGGTAAATACAGGAGTGCAGG + Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1065170184 10:23019212-23019234 CAGAGTAAAAAGTGGGGTGCAGG + Intronic
1067458608 10:46441074-46441096 CAGGATGAACACAGGAGGGCTGG + Intergenic
1067628588 10:47943562-47943584 CAGGATGAACACAGGAGGGCTGG - Intergenic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1069757523 10:70782290-70782312 CTGGGAAAAAACTGGGGTGCTGG - Intronic
1074116308 10:110459770-110459792 CAGGGAATGCACAGGGTTGCCGG + Intergenic
1076343949 10:129767812-129767834 CAGGATCGACACTGGGGTGCTGG - Exonic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078563603 11:12394723-12394745 CTGGGTATACACAGGGGTCCTGG - Intronic
1080559830 11:33452778-33452800 CAGGGGACACACAGGGGCGAGGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083273485 11:61583961-61583983 CAGGGTAAACACAGCAATGATGG - Intergenic
1083603331 11:63962116-63962138 CAGGCCTAACACTGGGGTGCTGG - Intergenic
1091358716 11:134957829-134957851 CAGGGGAAACAAAGTGGTGTCGG - Intergenic
1093444079 12:19234383-19234405 CAGGGAAAACACAGTTGTGAAGG - Intronic
1093786269 12:23195327-23195349 CCGGGTGAACAAGGGGGTGCTGG + Intergenic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1095978894 12:47959103-47959125 CAGGGCAGCCACAGGGCTGCTGG - Intergenic
1097882354 12:64697975-64697997 CAGGGCAAGAACAGGGGTGGAGG - Intergenic
1098818994 12:75207125-75207147 CAGGGTAAACCCAGGGACCCCGG - Intronic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1101812489 12:108119991-108120013 CATGGGAAACAAAGGGGAGCTGG - Intergenic
1102396296 12:112589067-112589089 CAGGAGAAACACAGGGTTTCTGG + Intronic
1104038438 12:125114451-125114473 CAGGGGAGACACGGGGGAGCGGG - Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1105816454 13:24040583-24040605 CCGGGGAGACACAGGGGTCCAGG + Intronic
1106332741 13:28754458-28754480 AAGGGGAAACACAGGGCAGCTGG + Intergenic
1106593244 13:31115798-31115820 CAAAGTAAACACAGGTGTGACGG - Intergenic
1110833349 13:80056867-80056889 CAAGGTAAACATGGGGATGCAGG - Intergenic
1112437026 13:99397893-99397915 CTGTGGAAACCCAGGGGTGCAGG + Intergenic
1112907038 13:104435445-104435467 CAGGCTAAAGTCAGGGGAGCAGG + Intergenic
1117348731 14:54860020-54860042 TTGGGTATACACAGGGGTCCTGG - Intronic
1117830324 14:59743715-59743737 CAGGGGAAACAAAGAGGTGAAGG - Intronic
1118162212 14:63301878-63301900 CAAGGGAAATACAGGGGTACAGG + Intergenic
1118390283 14:65290013-65290035 CAGGGATAAAACAGGGGTGGGGG - Intergenic
1119264312 14:73255015-73255037 CAGGGTAAGGACAGGAGGGCAGG + Exonic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1121021263 14:90581513-90581535 CAGTGGCAACACAGGGGAGCAGG + Intronic
1121320433 14:92988647-92988669 AGGGGTACACACAGGGGTGAGGG + Intronic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1124341687 15:28894091-28894113 TAGTGGAAACAAAGGGGTGCGGG + Intronic
1124965486 15:34429876-34429898 TAGTGGAAACAAAGGGGTGCGGG - Intronic
1124982111 15:34576083-34576105 TAGTGGAAACAAAGGGGTGCGGG - Intronic
1125728626 15:41880750-41880772 GCAGGTAAACCCAGGGGTGCTGG - Intronic
1126238152 15:46409729-46409751 CTTGGGAAACACAGGGATGCAGG - Intergenic
1126901390 15:53318237-53318259 CAGGCTAAAGGCTGGGGTGCAGG + Intergenic
1127427117 15:58867468-58867490 CAGAGTCAGCACAGAGGTGCTGG - Intronic
1129453586 15:75664179-75664201 CAGTGTGAACACAAGGGTGCTGG + Intergenic
1129762213 15:78136341-78136363 CAGGTTAAACAAGGGGTTGCAGG - Intronic
1131519331 15:93101470-93101492 CAGGGGAAGTACAGGGCTGCTGG + Intergenic
1131986031 15:98043625-98043647 CTGGGTAAACTCAGTGATGCCGG + Intergenic
1134350982 16:13437551-13437573 GAGGGTAAACACACGGGCCCTGG - Intergenic
1137604820 16:49780392-49780414 CAGGCGGAGCACAGGGGTGCTGG + Intronic
1139638588 16:68274693-68274715 CACAGCAAACACAGGTGTGCAGG + Exonic
1140598916 16:76451033-76451055 CTGGGGACACACAGGGGTGGTGG - Intronic
1141152755 16:81575549-81575571 CAGAGTAAACACAAGGGCCCTGG + Intronic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1144909727 17:18671417-18671439 CTGGGCAGACACAGCGGTGCTGG + Intronic
1145291377 17:21549277-21549299 CAGGGTTTACACAGGGGTGGGGG + Intronic
1145388698 17:22437776-22437798 CAGGGTTTACACAGGGGTGGGGG - Intergenic
1145961677 17:28890031-28890053 CAGGGACAACACTGGGGGGCTGG + Intronic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1148236722 17:45974124-45974146 CAGCGTTTACACAGGGCTGCCGG + Intronic
1150082684 17:62254313-62254335 CAGGGAAAAAAAAGGGGTGGGGG + Intergenic
1151360108 17:73583714-73583736 CAGGGTGAGCACACGGGTGGTGG + Intronic
1152284769 17:79405892-79405914 CAGGGAAAACTCAGAGGTGGTGG - Intronic
1156229619 18:35140690-35140712 CAGGATAAAAAGAGGGGTGGTGG - Exonic
1156448364 18:37253276-37253298 ATGGGGAAAGACAGGGGTGCAGG + Intronic
1157247867 18:46070331-46070353 CAGGGTGAAGACAGGGTTCCAGG - Intronic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1157710689 18:49847779-49847801 CAGGGCAAACCCAGGTGTTCAGG + Intronic
1163416167 19:17187766-17187788 CAGGGTGCACACGTGGGTGCTGG - Intronic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1165390122 19:35533917-35533939 TAGGGAGAACCCAGGGGTGCTGG + Intronic
1168404230 19:56102662-56102684 CAGGGAAAGCTCAGGAGTGCAGG - Intronic
928629654 2:33177961-33177983 CAGGGGGTACAGAGGGGTGCAGG - Intronic
928716882 2:34071507-34071529 CAGGGTAAACACAGCAGAACAGG - Intergenic
929745172 2:44649757-44649779 CAGGGTAAGGACAGGAGAGCAGG - Intronic
930105159 2:47633524-47633546 CAGGGGAAAACCAGGGGTGAAGG - Intergenic
930523169 2:52493798-52493820 CTGGGTAAACTGAGGGCTGCAGG - Intergenic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932880210 2:75494320-75494342 TGGGGTAAACACAGGGATGCTGG + Intronic
936069495 2:109356191-109356213 CTGGGAAAATACTGGGGTGCAGG - Intronic
936980157 2:118256491-118256513 GTGGGTAAACACATGGCTGCAGG + Intergenic
937478922 2:122239494-122239516 CTGGATAAACACGGGGATGCTGG + Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
940453881 2:153872448-153872470 CAGGGCAAAGGCAGGGGCGCGGG + Intronic
940741032 2:157507776-157507798 GAGGGTAAAGGCAGGGGTGAGGG + Intergenic
944311575 2:198239623-198239645 CAGCATAAACAGAGGTGTGCTGG - Intronic
946188111 2:217992666-217992688 CAGGGGAGAGAGAGGGGTGCGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948384897 2:237575212-237575234 CAGGGTAAACACAGGAGGGGCGG - Intronic
948883802 2:240873224-240873246 CAGTGGAAACACTGGGGTGCTGG - Intronic
948987849 2:241536275-241536297 CAGGGGAGACACAGAGGAGCTGG + Intergenic
1169912735 20:10660550-10660572 CAGGGCAATCCTAGGGGTGCAGG + Intronic
1173876327 20:46374517-46374539 CCGGGTAAAGGCAGGGGAGCTGG - Exonic
1175527235 20:59643745-59643767 CAGGGCAAATGCACGGGTGCTGG + Intronic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1175583517 20:60119060-60119082 CAGGGAACACATAGGGGAGCTGG - Intergenic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1178536477 21:33414226-33414248 CATCGCAATCACAGGGGTGCTGG - Intronic
1179305858 21:40153528-40153550 CATGGTGATCACAGGGGTGGGGG + Intronic
1182080321 22:27524277-27524299 CACGGTAAACCCAGCAGTGCAGG + Intergenic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1182892230 22:33828635-33828657 TGGGGAAACCACAGGGGTGCTGG - Intronic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG + Intergenic
1185310745 22:50152901-50152923 CAGGCGACACACAGGGGCGCAGG + Intronic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
950655369 3:14433130-14433152 CAGGGCCATCACAGGGGTACTGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
954316421 3:49804036-49804058 CAGGGCAGGCATAGGGGTGCTGG - Intronic
954577993 3:51687268-51687290 CAGGCTAAACACAGGGGCAGAGG - Intronic
956788302 3:72660969-72660991 CAGGGTACACACAGTGGGGTGGG + Intergenic
960122154 3:113957848-113957870 CCAGGTAAGCACAGGGCTGCTGG + Intronic
965099075 3:164273834-164273856 CTGGTTATACACATGGGTGCTGG - Intergenic
966316869 3:178657166-178657188 CAGGGAAAACATATGGGTTCTGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
968193802 3:196690501-196690523 CAGGAGAAACACAGGTGTCCAGG + Intronic
968287047 3:197514854-197514876 CAGGGAAATCACAGGGGAGGTGG + Intronic
968951466 4:3696531-3696553 CAGTGTAAACTCATGGCTGCTGG + Intergenic
968980692 4:3847884-3847906 CAAGGGAAACGCAGTGGTGCTGG + Intergenic
970756603 4:19434599-19434621 CAGGGTAAAATGAGGGGTGAGGG - Intergenic
976009638 4:80471849-80471871 CAATGTAAACACAGGTGTGTGGG - Intronic
977534551 4:98241909-98241931 GATGGTTAGCACAGGGGTGCGGG - Intergenic
979463988 4:121015587-121015609 CAGGGGTAACACAGGCGTGCTGG + Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
982301697 4:153885400-153885422 AAGGATGAACACAAGGGTGCTGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983928971 4:173432597-173432619 CACGGTAAACTCTGGGGAGCTGG - Intergenic
984220913 4:176973404-176973426 CAGGGAAAACACAGGGAAACTGG + Intergenic
984461778 4:180046214-180046236 CAGGGAACACTCAGGGGTACTGG - Intergenic
986548546 5:8926524-8926546 CTCAGTAAACACAGGAGTGCAGG - Intergenic
986580195 5:9257833-9257855 CAGGGTACACAGGGGTGTGCAGG + Intronic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
987412461 5:17627983-17628005 TAGGGTAAACATATGTGTGCAGG + Intergenic
990992031 5:61695999-61696021 TAGGGTAAACACACAGGAGCAGG - Intronic
991927935 5:71723230-71723252 CAGAGTAAAGGCAGGGGTGAGGG - Intergenic
997422701 5:133781657-133781679 CAGGGTACACACAGTGTGGCAGG - Intergenic
997810555 5:136963604-136963626 CAGGGGAAGCCCAGGGGTGAGGG + Intergenic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999317542 5:150594048-150594070 CAGGGTCAGCACAGCCGTGCAGG - Intergenic
1002333727 5:178463726-178463748 CGGTGTAAACACAGGGGGTCTGG + Intronic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1003738221 6:8902608-8902630 GAGGCTAAAGACAGAGGTGCTGG - Intergenic
1004600877 6:17148856-17148878 CAGGGTATACTCAGGCGTGCTGG - Intergenic
1004876137 6:19956810-19956832 TTGGGTAAAAACAGGGGAGCAGG + Intergenic
1013283941 6:108664320-108664342 CTGGGCAGACACAGCGGTGCTGG - Exonic
1015787554 6:136933322-136933344 TTGGGTAAAAACAGGAGTGCAGG - Intergenic
1018982697 6:168612793-168612815 CAGGCGAAAGACAGAGGTGCAGG + Intronic
1019577123 7:1743020-1743042 CAGGGAAAACACAGGCGGCCGGG + Intronic
1019781254 7:2941284-2941306 CAGGTTAATCACTGGGGTGCAGG - Intronic
1020005789 7:4783281-4783303 CAGGGCAAACGCTGGGGTACTGG - Intronic
1026569762 7:71519194-71519216 CCAGATAAACACAGGGATGCAGG + Intronic
1027055514 7:75046832-75046854 CAGGTGAAAGACGGGGGTGCGGG + Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029559146 7:101290897-101290919 CAGTGAAAACACAGGGGTCTTGG + Intergenic
1033259573 7:139831185-139831207 CAGGGGAGACACAGAGGTTCTGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1036289421 8:7474126-7474148 AAGGGTAAAAAGATGGGTGCTGG + Intronic
1037141900 8:15530303-15530325 TAGGGTAAACACAGGAGTAGGGG - Intronic
1037819426 8:22128603-22128625 CGGAGTATACCCAGGGGTGCGGG + Exonic
1038764553 8:30415128-30415150 GAGGAGGAACACAGGGGTGCAGG - Intronic
1042955341 8:74244317-74244339 CTGGGTGAACATAGGGGTGGTGG + Intronic
1044483336 8:92719208-92719230 CACTGTAAACACAGTGGTTCTGG + Intergenic
1045503589 8:102762071-102762093 CAGCGTAGGGACAGGGGTGCTGG + Intergenic
1046697792 8:117361200-117361222 CAGGGTAAACACTTTGGAGCAGG - Intergenic
1047255741 8:123212260-123212282 CAGGGAGACCCCAGGGGTGCAGG - Intergenic
1048910980 8:139134823-139134845 CAGGGTTCACACAGGTTTGCAGG + Intergenic
1056899393 9:90584012-90584034 CAGGGTATCCACAGGGTCGCTGG - Intergenic
1059655277 9:116352231-116352253 CAGGACAGATACAGGGGTGCTGG + Intronic
1061902884 9:133681891-133681913 GAGGGGAAACACAGGGGAGGTGG - Intronic
1062397963 9:136360098-136360120 CAGGGGACACACAGGTGCGCCGG + Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1062453894 9:136626838-136626860 GAGTGCAAACACAGGGGTGGAGG + Intergenic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1192044514 X:67657913-67657935 CAGGGTCAAAACAGGGGTTTGGG + Intronic
1193072963 X:77326018-77326040 TACATTAAACACAGGGGTGCAGG - Intergenic
1194296979 X:92138052-92138074 CAGTGAGAACACATGGGTGCAGG - Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196444346 X:115737559-115737581 CAGGCGACACACAAGGGTGCCGG + Intergenic
1197512688 X:127390253-127390275 CAGGGTGACCACAGAGGTCCTGG + Intergenic
1197784375 X:130185996-130186018 CAGGGCAAAATCAGGGGGGCAGG + Intergenic
1200614490 Y:5362627-5362649 CAGTGAGAACACATGGGTGCAGG - Intronic