ID: 1062407147

View in Genome Browser
Species Human (GRCh38)
Location 9:136402292-136402314
Sequence GTCACTCTTGTGGCCCCAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1564
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 1484}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062407147_1062407157 7 Left 1062407147 9:136402292-136402314 CCCACTGGGGCCACAAGAGTGAC 0: 1
1: 0
2: 5
3: 74
4: 1484
Right 1062407157 9:136402322-136402344 CCAGAGGGAGCCCTGAGCATCGG 0: 1
1: 0
2: 4
3: 29
4: 278
1062407147_1062407158 10 Left 1062407147 9:136402292-136402314 CCCACTGGGGCCACAAGAGTGAC 0: 1
1: 0
2: 5
3: 74
4: 1484
Right 1062407158 9:136402325-136402347 GAGGGAGCCCTGAGCATCGGCGG 0: 1
1: 0
2: 2
3: 16
4: 199
1062407147_1062407153 -8 Left 1062407147 9:136402292-136402314 CCCACTGGGGCCACAAGAGTGAC 0: 1
1: 0
2: 5
3: 74
4: 1484
Right 1062407153 9:136402307-136402329 AGAGTGACCCGGGAGCCAGAGGG 0: 1
1: 0
2: 2
3: 22
4: 183
1062407147_1062407152 -9 Left 1062407147 9:136402292-136402314 CCCACTGGGGCCACAAGAGTGAC 0: 1
1: 0
2: 5
3: 74
4: 1484
Right 1062407152 9:136402306-136402328 AAGAGTGACCCGGGAGCCAGAGG 0: 1
1: 0
2: 1
3: 27
4: 253
1062407147_1062407159 14 Left 1062407147 9:136402292-136402314 CCCACTGGGGCCACAAGAGTGAC 0: 1
1: 0
2: 5
3: 74
4: 1484
Right 1062407159 9:136402329-136402351 GAGCCCTGAGCATCGGCGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 95
1062407147_1062407162 20 Left 1062407147 9:136402292-136402314 CCCACTGGGGCCACAAGAGTGAC 0: 1
1: 0
2: 5
3: 74
4: 1484
Right 1062407162 9:136402335-136402357 TGAGCATCGGCGGAAGGCACAGG 0: 1
1: 0
2: 1
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062407147 Original CRISPR GTCACTCTTGTGGCCCCAGT GGG (reversed) Exonic