ID: 1062407562

View in Genome Browser
Species Human (GRCh38)
Location 9:136404039-136404061
Sequence CCTCCCAGGCACTCACTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 166}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062407554_1062407562 -3 Left 1062407554 9:136404019-136404041 CCCCGCCAGGCTTCCCGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 207
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166
1062407548_1062407562 13 Left 1062407548 9:136404003-136404025 CCAATCTCACCCCTTTCCCCGCC 0: 1
1: 0
2: 1
3: 52
4: 537
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166
1062407550_1062407562 4 Left 1062407550 9:136404012-136404034 CCCCTTTCCCCGCCAGGCTTCCC 0: 1
1: 0
2: 4
3: 39
4: 460
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166
1062407547_1062407562 18 Left 1062407547 9:136403998-136404020 CCACTCCAATCTCACCCCTTTCC 0: 1
1: 0
2: 3
3: 65
4: 619
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166
1062407552_1062407562 2 Left 1062407552 9:136404014-136404036 CCTTTCCCCGCCAGGCTTCCCGG 0: 1
1: 0
2: 3
3: 23
4: 249
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166
1062407556_1062407562 -5 Left 1062407556 9:136404021-136404043 CCGCCAGGCTTCCCGGTGCCTCC 0: 1
1: 0
2: 0
3: 56
4: 362
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166
1062407555_1062407562 -4 Left 1062407555 9:136404020-136404042 CCCGCCAGGCTTCCCGGTGCCTC 0: 1
1: 0
2: 2
3: 21
4: 271
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166
1062407551_1062407562 3 Left 1062407551 9:136404013-136404035 CCCTTTCCCCGCCAGGCTTCCCG 0: 1
1: 0
2: 0
3: 14
4: 202
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166
1062407557_1062407562 -8 Left 1062407557 9:136404024-136404046 CCAGGCTTCCCGGTGCCTCCCAG 0: 1
1: 0
2: 2
3: 38
4: 438
Right 1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG 0: 1
1: 0
2: 0
3: 21
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062407562 Original CRISPR CCTCCCAGGCACTCACTTGA TGG Exonic
900229727 1:1550602-1550624 CATCCCTGGCAGGCACTTGAGGG - Intronic
900440111 1:2650623-2650645 GCTCTCAGACACTCACCTGAAGG - Intronic
900661301 1:3785379-3785401 CCAGCCAGGCACTCACTTTGTGG + Intronic
900685101 1:3943256-3943278 CCTCCGAGGCAGTCACTGGTGGG + Intergenic
900769084 1:4526590-4526612 ACTCCCTGGCACTCACTTCACGG + Intergenic
904790568 1:33017330-33017352 CCTTCCAGGCACTCAAATAATGG - Intronic
905281586 1:36852796-36852818 GCTCCCAGGGACCCACTTGCTGG + Intronic
906614472 1:47225250-47225272 CCTCACTGGCACTCACTCGGGGG + Intronic
911681383 1:100719785-100719807 CCTCCCAGGCACACACAGGTGGG + Exonic
912212418 1:107570077-107570099 TGTCCAAGGCACTCACTTTATGG + Intergenic
916172779 1:162013255-162013277 CTTCCCAGCCACTCACAGGAAGG + Intronic
919330369 1:196163083-196163105 CATCCATGGCACTCACTTTAGGG + Intergenic
919842404 1:201618990-201619012 CCTCCCAGGCTCCCACCTGGGGG + Intergenic
921660255 1:217792848-217792870 CCTCTCATGCCCTGACTTGATGG + Intronic
1063951002 10:11223476-11223498 CCTCCTAGGCAGTCCCATGAGGG - Intronic
1064067679 10:12196408-12196430 CCTCCCATGCAGTCGCTAGAAGG - Intronic
1064550785 10:16498967-16498989 CCTCCAAGGCACTCACACTACGG - Intronic
1065961536 10:30737978-30738000 CCTACCAGGCTCTCACCTGGAGG + Intergenic
1066384819 10:34933183-34933205 CCTCCCAGCCTCTCACTTGGCGG - Intergenic
1073540920 10:104315699-104315721 CCGCCCAGGCACTCAGGTGAGGG + Exonic
1073599195 10:104830368-104830390 CCTCCTAGGCAGTCACGTGATGG - Intronic
1076688559 10:132209160-132209182 ATGCCCAGACACTCACTTGAGGG - Intronic
1076904300 10:133354657-133354679 CCTCCCAGGCACCCCCTTTCAGG + Intergenic
1077009259 11:372941-372963 CAACCCCGGCACTCACATGAGGG - Exonic
1077125246 11:931618-931640 CCCCCCAGGTCCTCACATGAAGG + Intronic
1078132280 11:8622657-8622679 CATCCCAGACATCCACTTGAAGG + Intronic
1078507124 11:11960593-11960615 CCTCCCTGACACTCCGTTGAGGG - Intergenic
1078746388 11:14119464-14119486 ACTCCCAGGCACTTGCTTGCTGG + Intronic
1079087618 11:17458093-17458115 CATCCCAGGCAACCACATGATGG + Intronic
1079135652 11:17774817-17774839 CTTCCCAAGCACTCACTTCCCGG + Intronic
1080076765 11:28158708-28158730 TGTCCAAGGCACTCACTTTATGG + Intronic
1083390134 11:62343027-62343049 ACTCCCAGGTACTCACCTAAGGG - Intronic
1084438763 11:69158723-69158745 CTTCCCAGCCACACACTTGCAGG - Intergenic
1084564401 11:69921013-69921035 GCTCCCAGGGACTCATCTGAGGG - Intergenic
1091637806 12:2211200-2211222 CCTCCCAGGCAGTCAGGTCAAGG + Intronic
1093436742 12:19143274-19143296 CCTTGCAGGCACTTGCTTGATGG + Intronic
1095399147 12:41794672-41794694 TCTGCCAGGAACTCGCTTGAAGG + Intergenic
1095529629 12:43171310-43171332 CCTCCCAGGCACTCCCACGAAGG + Intergenic
1102124512 12:110469143-110469165 GCTCCCCGCCTCTCACTTGAGGG - Intronic
1105599589 13:21874886-21874908 CCTCTCAGGCACTCACTGCTTGG + Intergenic
1115887483 14:37989265-37989287 CATCCCAGGGACTCACTTGGAGG - Intronic
1116336683 14:43665936-43665958 CCTTCCAGGCACTCATGTGCTGG - Intergenic
1117451072 14:55850614-55850636 CCTCCCTGGCAATCTCTTGATGG - Intergenic
1117665923 14:58055783-58055805 CCTACCAGGAACAAACTTGATGG + Intronic
1118611592 14:67545188-67545210 CCTCCGAGTCACTAACTTAAAGG - Intronic
1118901993 14:69993875-69993897 GCACCCTGGCACTCTCTTGATGG + Intronic
1120101079 14:80446319-80446341 CTTCCAGGGCACTCAATTGAAGG - Intergenic
1121495010 14:94386139-94386161 CCTCCCAGGCACTAGCTTTTAGG - Intronic
1121526967 14:94625807-94625829 ACTCCATGGCACTCATTTGAGGG - Intergenic
1121622528 14:95360449-95360471 CCTCCCAGGCGCGACCTTGATGG + Intergenic
1122765226 14:104064524-104064546 CCTGCCAGGCACTGACTGGCAGG + Intergenic
1123791729 15:23727957-23727979 CCTGCCAGGCAGTTCCTTGATGG - Intergenic
1124880707 15:33640030-33640052 TCTGCCAGGCACTCCCCTGAGGG + Intronic
1125062215 15:35437969-35437991 CCTCCCAGGGACTCAGAGGAAGG - Intronic
1125556696 15:40591680-40591702 CCGCCCAGGCAGTGACATGATGG + Intergenic
1125747288 15:42005500-42005522 CCTCACAGGCACTCAAATGCTGG + Intronic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1128602726 15:69011388-69011410 CCTCACAGGCACTCACAAGCCGG + Intronic
1129297947 15:74610116-74610138 CCTGCCATGCACCCACTTGGGGG + Intronic
1129451187 15:75652196-75652218 CTTCCCACCCACTCCCTTGAAGG - Intronic
1130561804 15:84964758-84964780 CCTCCCATGCATTCATTAGATGG + Intergenic
1132376190 15:101329824-101329846 CCTCCCAGCCACTCTCTTGCAGG + Intronic
1132891364 16:2206354-2206376 CCTCCAAGGCATTCACCTGCTGG - Exonic
1134688244 16:16173380-16173402 CTTCTCAGGGACTGACTTGATGG + Exonic
1136934022 16:34442384-34442406 CCTCCCAGGAACTGACTTTGCGG - Intergenic
1136970550 16:34969430-34969452 CCTCCCAGGAACTGACTTTGCGG + Intergenic
1137577945 16:49615914-49615936 CCTCCCTGGAACTGACTTGCAGG - Intronic
1144624698 17:16838773-16838795 CCTCCCACCCACTCACTTTGTGG + Intergenic
1144854770 17:18261662-18261684 CCACCCAGCCACACACTTCAAGG + Intronic
1144881732 17:18433948-18433970 CCTCCCACCCACTCACTTTGTGG - Intergenic
1145001220 17:19306085-19306107 TTTCCCAGACACTCACTGGAAGG - Intronic
1145150501 17:20510438-20510460 CCTCCCACCCACTCACTTTGTGG + Intergenic
1148564282 17:48624291-48624313 CATCCCAGGCAATCACATTAAGG - Intronic
1149255043 17:54816626-54816648 TCACCAAGGCACTCACTTTATGG + Intergenic
1151850057 17:76684845-76684867 CCTCCCTGGCACTGACCAGAAGG - Intronic
1152703741 17:81832693-81832715 CCTTCTAGGCACTCACTGGGCGG - Intronic
1152868994 17:82741387-82741409 TCACCCAGGCACTCACCTGCGGG - Exonic
1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG + Intronic
1155037787 18:22039788-22039810 CCTCCCAGGCCTTCCATTGATGG + Intergenic
1156389017 18:36633361-36633383 ACTGCCAGGCCATCACTTGATGG + Intronic
1157210228 18:45735825-45735847 CCTCATAGGCTCTCACTTGTTGG - Intronic
1157847785 18:51019505-51019527 CCTCCCAGGCCCTGGCTTCAGGG + Intronic
1159927494 18:74282068-74282090 GCTCCCAGGCAGTCAGTAGAAGG - Intronic
1161595596 19:5149629-5149651 CCTCCCTGGCACGCCCTTCATGG + Intronic
1162736806 19:12751597-12751619 CCTCCCAGTCGCTCACTGGCAGG - Intergenic
1163494742 19:17639751-17639773 CCTCCCATGCACACACCTGCTGG + Intronic
1164596518 19:29533923-29533945 CCTCCCAGCCACTCAATTCTAGG + Intronic
1167263791 19:48473372-48473394 CCTCCCCCTCACTCACCTGAGGG - Exonic
1167525199 19:49979261-49979283 CCTCTCAGGCTCTCCCTTGCTGG - Intronic
925772580 2:7297826-7297848 TGTCCAAGGCACTCACTTTATGG - Intergenic
926983089 2:18592277-18592299 CTTCCCATGCACTAACTTCATGG - Intergenic
930596150 2:53390361-53390383 CTCCACTGGCACTCACTTGAGGG - Intergenic
934759747 2:96847785-96847807 CGTGCCAGGCACTCTCTCGAGGG + Intronic
936454888 2:112665459-112665481 CCTCCCAGACCCTCAGTTCAAGG - Intergenic
942621466 2:177848691-177848713 CCTCACCGGCCCTCACTTCAGGG - Intronic
944692441 2:202170121-202170143 CCTCCCAGGCTGTCACCTGAGGG - Intronic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
946207953 2:218124401-218124423 TCTCCCAGGCACTCTCATCAAGG - Intergenic
946284692 2:218694137-218694159 CCTCCAAGGCACAAAGTTGATGG - Intronic
947807195 2:232976998-232977020 CCTCCCAGGCACTCCCGGGAAGG - Intronic
1169236688 20:3935465-3935487 GCTCCCAAGCACTCACTGAAAGG + Intronic
1169740003 20:8881790-8881812 CCTCCCAGCTCCTCACTGGAGGG - Exonic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172900774 20:38333030-38333052 CTTACAAGGCACTCACTTGGTGG - Intronic
1173564394 20:44028669-44028691 CCTCCCTGGCACTCAGATGGGGG + Intronic
1175125552 20:56748792-56748814 CCTCCCCAGCACTCACTTCAAGG - Intergenic
1175298665 20:57927451-57927473 TCTCCCAGGCACTCAGTCCAAGG + Intergenic
1179922727 21:44515915-44515937 CGTCCCAGGCACTCCCGTCACGG + Intronic
1179994354 21:44967175-44967197 CCTCCCGGACACTCACCTGCGGG - Exonic
1180697059 22:17758250-17758272 CCTCGCAGGCACTGACTCCACGG + Intronic
1180845733 22:18980682-18980704 TCACCCAGGCACTCACCTGTGGG + Intergenic
1182357025 22:29726869-29726891 ACTCCCTGGCACACAGTTGAGGG - Intronic
1184982036 22:48101796-48101818 CATCCCAGGAACTCACTTCAGGG - Intergenic
1185396326 22:50592349-50592371 TCTCTCAGTCACTCCCTTGAAGG - Intronic
950521812 3:13501927-13501949 CCTGCAGGGCACTCACCTGATGG - Exonic
950523146 3:13508148-13508170 CCTCCCTAGCAATCACGTGACGG - Intergenic
954533864 3:51343471-51343493 GCTCCAAGGCACTCACTCCAAGG + Intronic
955596640 3:60597657-60597679 CCTCCCATGTTCACACTTGAGGG - Intronic
961648331 3:128404620-128404642 CAGGCCAGGCGCTCACTTGAGGG + Intronic
961710811 3:128826828-128826850 CGACCAAGGCACTCACTTTACGG - Intergenic
961832753 3:129632597-129632619 CCTCCCAGTCCCTCAATGGATGG - Intergenic
962839135 3:139217810-139217832 CCTCCCAAGCCCACACTTGAGGG - Intronic
963806465 3:149727936-149727958 CCTCACAAGCACTCGCTTCAAGG + Intronic
968443026 4:634081-634103 CCTCCCAGGCACACACTCCCAGG - Intronic
968882526 4:3308860-3308882 CCTCCCAGGCCCTTTGTTGAAGG + Intronic
971232048 4:24807878-24807900 CCTCCTGGGCCCTGACTTGATGG + Exonic
971539368 4:27796389-27796411 CCTCCCAGGCACTAAGATGGAGG - Intergenic
972838862 4:42907883-42907905 ACTCCCAGTCACTCACATGGAGG - Intronic
979075553 4:116265217-116265239 CTTACCAGGCACTCAGTTTATGG + Intergenic
984045458 4:174792292-174792314 CCTCCGAGGCCCTCCCTTGTTGG + Intronic
985668809 5:1195973-1195995 CCTCCCAGGCACGCAGTCGACGG + Intergenic
985668831 5:1196065-1196087 CCTCCCGGGCACGCAGTCGACGG + Intergenic
985668843 5:1196111-1196133 CCTCCCGGGCACGCAGTCGACGG + Intergenic
985668852 5:1196153-1196175 CCTCCCAGGCACGCAGTCGATGG + Intergenic
987385875 5:17328832-17328854 ACACCCTGGCACTCACTTGCTGG - Intergenic
988241834 5:28621315-28621337 CACCCCAGACACTCATTTGAGGG + Intergenic
989123221 5:38025688-38025710 CCTCCCAGGCCCTGGCGTGAAGG + Intergenic
992067946 5:73124437-73124459 CCTCCCAGGCTGTCACTAGCTGG + Intronic
994431083 5:99662123-99662145 ACTTCCAGGCCCTCAATTGATGG + Intergenic
995394303 5:111670996-111671018 TTTCCTAGACACTCACTTGAGGG - Intronic
997613714 5:135232229-135232251 CCTCCTAGCCCCTCTCTTGATGG - Intronic
998080100 5:139267945-139267967 TCTCTCAGGCATCCACTTGATGG - Intronic
998390068 5:141781640-141781662 CCTGCCTGCCACTCACTTGCTGG - Intergenic
999384735 5:151146065-151146087 CCACCCTGGGACTCACTTGCAGG + Intronic
999467716 5:151823021-151823043 CCTGCAAGGCACTCCCTTGGGGG + Intronic
999769029 5:154761239-154761261 CCTGGCAGGCACTCACTTCCGGG - Intronic
1001547577 5:172579998-172580020 GCTCCCAGGCAGTTACTAGAAGG - Intergenic
1003158485 6:3616426-3616448 TCTCCAAAGCAGTCACTTGAAGG - Intergenic
1003403774 6:5811545-5811567 CCTATCAGGCTCTCACATGAGGG + Intergenic
1004471828 6:15936381-15936403 CCTCCCAGAAACTCACTTAAAGG + Intergenic
1006807506 6:36798149-36798171 CAACCCAGACACTCACGTGAGGG + Exonic
1012997955 6:105992558-105992580 CCTCCCTGGCGCTCACTCGGCGG - Intergenic
1013996428 6:116314048-116314070 CCTCTCAGCCACTGCCTTGATGG + Intronic
1015474494 6:133644983-133645005 CTTTCAAGGCACTCACATGATGG - Intergenic
1018600050 6:165528690-165528712 TGACCCAGGCACTCACTTTATGG + Intronic
1018977412 6:168575905-168575927 CCTCCCAAGCACCCAGGTGAAGG + Intronic
1019406995 7:889128-889150 CCTCCCATGCACTCCCTGGACGG - Intronic
1019736430 7:2652236-2652258 CCTCCCAGGCTCTCACCTGCTGG - Exonic
1023041935 7:36180044-36180066 GCTCCCAGACACCCACCTGAGGG + Intronic
1023697110 7:42858883-42858905 CCTCCCAAGCACCCACTCCAGGG + Intergenic
1025711464 7:63914196-63914218 CATCCCAGGCACTCAGGTGGAGG + Intergenic
1028836021 7:95376163-95376185 CTTCCCTGGCACTCTCTTGTGGG - Intronic
1032236209 7:130125879-130125901 CCTCCCAGGCATTCGTTTCAAGG - Exonic
1032418711 7:131760097-131760119 CATCCCAGGCACCCATTTGTTGG + Intergenic
1034940044 7:155224791-155224813 CCTCCCAGCCCCTCCCTGGATGG - Intergenic
1035010719 7:155713336-155713358 CCTCCAGGGCTCTCATTTGAGGG - Intronic
1035052143 7:156005130-156005152 CCTCACCGGCACCCACTTGCAGG + Intergenic
1035232742 7:157476266-157476288 CCTGCCAGGCACTCAGTGGCTGG - Intergenic
1036412675 8:8517187-8517209 CCTTCCTGGCACTCACTTTTGGG - Intergenic
1037005979 8:13780258-13780280 CCATCCAGGAACTCACATGATGG + Intergenic
1038005311 8:23424738-23424760 CCTCCCTGGCCCTGAATTGAGGG + Intronic
1038043409 8:23746033-23746055 CCTTCAAGGGACTCCCTTGAAGG - Intergenic
1039976421 8:42370151-42370173 GCTCCTAGGCCCTCAGTTGAAGG + Intronic
1040054129 8:43042733-43042755 CCTCCCAGGCACTCCCCTAAGGG - Intronic
1041501006 8:58538719-58538741 CCTCAGAAGCACTCACGTGATGG - Intergenic
1042790722 8:72602770-72602792 CCTTCCAGCCACTCTCATGAAGG - Intronic
1046972742 8:120240307-120240329 CCTCTCAGGGACTCACCTGAGGG + Intronic
1049169460 8:141150010-141150032 CCTCCCAGGTGTTCCCTTGATGG + Intronic
1051752700 9:20360210-20360232 CCTCCTTGGCACTCAGTTGATGG - Intronic
1052737174 9:32354388-32354410 TCACCAAGGCACTCACTTTAAGG - Intergenic
1054822679 9:69539149-69539171 CCTCCCAGGTGATCACATGAAGG + Intronic
1056495608 9:87151982-87152004 CCTCCTAGGAACTCATTTAAGGG + Intronic
1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG + Exonic
1186534915 X:10337077-10337099 CCTCACAGCCCCTCACTTCACGG + Intergenic
1187301819 X:18058272-18058294 CCACCCCAGCACTCAGTTGATGG - Intergenic
1187757941 X:22546925-22546947 CCTCCAGGGCACTACCTTGAAGG - Intergenic
1187972020 X:24668302-24668324 ATTCCCAGGCATTCACTTGCGGG - Intronic
1191759516 X:64631084-64631106 TCACCAAGGCACTCACTTTATGG + Intergenic