ID: 1062407801

View in Genome Browser
Species Human (GRCh38)
Location 9:136405298-136405320
Sequence CCTGTGATGGAATGGGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062407794_1062407801 -2 Left 1062407794 9:136405277-136405299 CCAGATAAAACCCGCTAAGAGCC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1062407801 9:136405298-136405320 CCTGTGATGGAATGGGTCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 129
1062407793_1062407801 7 Left 1062407793 9:136405268-136405290 CCTCATGAGCCAGATAAAACCCG 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1062407801 9:136405298-136405320 CCTGTGATGGAATGGGTCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062407801 Original CRISPR CCTGTGATGGAATGGGTCTC AGG Intronic
900040395 1:457532-457554 CCAGTGAAGGTATGGGTCCCGGG + Intergenic
900061825 1:692503-692525 CCAGTGAAGGTATGGGTCCCGGG + Intergenic
901139550 1:7019549-7019571 CCTGGGAAGGAAAGGGTCGCTGG - Intronic
901212411 1:7534088-7534110 CCGGTGATGGGAGGGGCCTCAGG - Intronic
904980548 1:34497378-34497400 CCAGTGATGGATTGGGTATGAGG + Intergenic
907334773 1:53692935-53692957 CCTGGGATGGGATGGGCCCCTGG - Intronic
915363470 1:155300280-155300302 CCTGTGGTAGAAGGGGGCTCAGG + Exonic
922040214 1:221889078-221889100 CCTGTTATGTAATGATTCTCGGG + Intergenic
1069893818 10:71668147-71668169 GCTGTGGTGGCAGGGGTCTCTGG - Intronic
1069893824 10:71668169-71668191 GCTGTGGTGGCAGGGGTCTCTGG - Intronic
1075791187 10:125085518-125085540 CCTGGGATGGAAATTGTCTCTGG - Intronic
1076350457 10:129811588-129811610 CCCGTGTTGGCATGGGCCTCAGG - Intergenic
1076859846 10:133135543-133135565 CCTGTGGTGGGGGGGGTCTCTGG + Intergenic
1076859929 10:133135759-133135781 CCTGTGGTGGGGGGGGTCTCTGG + Intergenic
1076860009 10:133135974-133135996 CCTGTGGTGGGGGGGGTCTCTGG + Intergenic
1076860147 10:133136351-133136373 CCTGTGGTGGGGGGGGTCTCTGG + Intergenic
1076860205 10:133136512-133136534 CCTGTGGTGGGGGGGGTCTCTGG + Intergenic
1076860437 10:133137159-133137181 CCTGTGGTGGGGGGGGTCTCTGG + Intergenic
1076860991 10:133138673-133138695 CCTGTGGTGGGGGGGGTCTCTGG + Intergenic
1076966616 11:93434-93456 CCAGTGAAGGTATGGGTCCCGGG + Intergenic
1080589901 11:33713451-33713473 CCTCTGAGGGGATGGGTATCTGG + Intronic
1086919494 11:92570187-92570209 ACTGTGAGGGAATGAGGCTCAGG - Intronic
1087239761 11:95761651-95761673 CTTGTGATGGGATGGGTAGCTGG + Intergenic
1087955683 11:104284879-104284901 CCTGTGATAGAATAGATCTACGG + Intergenic
1089517879 11:119045237-119045259 CCGGTGATGGGAAGGGTATCAGG - Exonic
1090485981 11:127112431-127112453 GCTGTGGTGGAAGGGGTCTGGGG + Intergenic
1093199749 12:16172333-16172355 CCTCTGATGGAATGGTTTTTAGG - Intergenic
1095473000 12:42556308-42556330 CTTGTGATGGAATGGGGCAAAGG - Intronic
1096192993 12:49632334-49632356 ACTGTGAAGGAATGAGCCTCGGG + Intronic
1096740769 12:53692538-53692560 CCTGTGGAGGAAGGGGTCTGTGG - Intergenic
1098721206 12:73900551-73900573 CATGTGATGGAATGTTTCCCTGG - Intergenic
1104970839 12:132529919-132529941 CCTGTGCTGCATGGGGTCTCAGG + Intronic
1107982784 13:45749336-45749358 CCTCTGATGGAACAGGTCACTGG + Intergenic
1109857874 13:68156637-68156659 CCTGTGATGGGAGGGGTTGCTGG + Intergenic
1113032514 13:106010003-106010025 ACTGTTAGGGAATGGGTCTTTGG + Intergenic
1113628131 13:111861570-111861592 CCTGTTATGGAATTGGTCATGGG + Intergenic
1114416353 14:22547319-22547341 CTCGTGATGGACTGGGACTCAGG - Intergenic
1114585546 14:23809833-23809855 CCTGTCATGAAATGGGGCACGGG + Intergenic
1119679318 14:76580072-76580094 CCTGTGATTGATTGGATCACTGG + Intergenic
1122024560 14:98866400-98866422 CCTGTGGTGGGATGGGACACAGG - Intergenic
1125256698 15:37772220-37772242 TCTGTGGTTGAATGTGTCTCTGG + Intergenic
1125593867 15:40872413-40872435 CCTGGGAAGAACTGGGTCTCTGG - Exonic
1132441513 15:101870089-101870111 CCAGTGAAGGTATGGGTCCCGGG - Intergenic
1132526214 16:416470-416492 CCAGTGACCGCATGGGTCTCAGG + Intergenic
1138192132 16:55022232-55022254 CCTGTGATGTGATCGGTCTTCGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1145996014 17:29105470-29105492 ACACTGATGGAATGGGTCTCTGG + Intronic
1146397636 17:32481404-32481426 CCTGTGAAGGAATGGGGATGAGG + Exonic
1149110497 17:53022686-53022708 TCTGTGATTGAATGGGGCTTAGG + Intergenic
1152064648 17:78104058-78104080 CCTGTGTAGGAATGTGTCACAGG - Intronic
1153069840 18:1092462-1092484 CCTGTGCTCAGATGGGTCTCTGG - Intergenic
1157725775 18:49962632-49962654 CCTGTGATTGAATGGGAATACGG - Intronic
1158497676 18:57970950-57970972 CATGTGATGTAATTGGTCTGGGG + Intergenic
1160643419 19:163057-163079 CCAGTGAAGGTATGGGTCCCGGG + Intergenic
1162775193 19:12975111-12975133 CCTGTGAGGTCAGGGGTCTCAGG - Intergenic
1164123715 19:22291193-22291215 CCTGGTCTGGAATGGATCTCTGG + Intronic
1164176320 19:22778306-22778328 CCTGGTCTGGAATGGATCTCTGG - Intronic
1164686100 19:30167728-30167750 CCAGTGATGGGATTGGTCTGGGG - Intergenic
1166375265 19:42324177-42324199 CCTGGGGTGGAAGGGTTCTCCGG + Intronic
1166384305 19:42371628-42371650 CCTGTAACTGAATGGGGCTCAGG - Intronic
1167309806 19:48730460-48730482 CATGTTAAGAAATGGGTCTCTGG - Intronic
925552236 2:5089201-5089223 CCTGTGATGGAAAAGGGCCCAGG + Intergenic
925922511 2:8647037-8647059 CCTGGGATGGAGTGGATCTCGGG - Intergenic
925965812 2:9064825-9064847 CCTTTGAGGGAATGCATCTCAGG - Intergenic
931746428 2:65295345-65295367 CCTGGGAAGGGAAGGGTCTCTGG + Intergenic
932139303 2:69261502-69261524 CCTGGGATGCCTTGGGTCTCTGG - Intergenic
932343486 2:70980992-70981014 GCTGTGATTTAATGGGTCTGTGG + Intronic
933448123 2:82408834-82408856 CCTGTGTTGGAATGGGGACCTGG - Intergenic
935178920 2:100673329-100673351 CCTGTGATGGAAGGGGCTTGGGG + Intergenic
935958037 2:108398206-108398228 CTTATGAAGGGATGGGTCTCAGG + Intergenic
936659124 2:114522882-114522904 CATGAGAGTGAATGGGTCTCAGG - Intronic
937297272 2:120817379-120817401 CATGTGATGGAAGGGGTGACAGG - Intronic
944230765 2:197389881-197389903 CCTCTAATGGAATTGATCTCTGG - Exonic
1170732555 20:18987333-18987355 ACTGAGAGGGAGTGGGTCTCGGG + Intergenic
1171343382 20:24447497-24447519 CCTGTGAAGGCAGGGGGCTCAGG - Intergenic
1177974920 21:27836658-27836680 CATGTGAAAGAATGGTTCTCAGG - Intergenic
1178030629 21:28521416-28521438 CCTGTGATTAAATGAGTCTGGGG - Intergenic
1180024427 21:45151610-45151632 CCTGAGATGGCCTGTGTCTCTGG - Intronic
1183377574 22:37474022-37474044 ACCGGGATGGAATGGGTCTTTGG - Intronic
950430446 3:12947860-12947882 CCTGTGATGGAAGTGGTATGTGG + Intronic
952889413 3:38030420-38030442 TCTGTGGTGGGAGGGGTCTCTGG - Intergenic
955902265 3:63769731-63769753 CCTGTGTTAGAATGAGTCTTTGG - Intergenic
958146476 3:89631387-89631409 CCTGTGATGGGAGGGGTTGCCGG - Intergenic
963466718 3:145691058-145691080 CCTATGGTGGATTGGGTATCTGG + Intergenic
965372512 3:167881278-167881300 CCTGTCGTGGCATGTGTCTCAGG + Intergenic
969515869 4:7648053-7648075 CCTGAGATGGAATGGGGTGCCGG + Intronic
980338066 4:131501225-131501247 CCTCAGGTGGAATGAGTCTCTGG - Intergenic
982631147 4:157830905-157830927 CTTGTGATGAAATGGGTTTCTGG - Intergenic
984561752 4:181279175-181279197 CCAGTGTTTGAATGGCTCTCCGG - Intergenic
985220563 4:187699215-187699237 CCTGTGATGGAATGAGCCACTGG - Intergenic
987782948 5:22462596-22462618 CCTGTGAAGATCTGGGTCTCTGG + Intronic
988875840 5:35444688-35444710 CCTGTGATGCGATCTGTCTCAGG - Intergenic
990247903 5:53881631-53881653 CCTGTGATGGAAGTGATCTTAGG + Intergenic
995131119 5:108631507-108631529 CCTGTGTTGGTTTGGGTTTCAGG - Intergenic
999673909 5:153980494-153980516 CCTGAGAGGGAATGGGTCTTTGG - Intergenic
1001334122 5:170783715-170783737 CCTCAGATGGAGTGGCTCTCTGG - Exonic
1001529293 5:172451212-172451234 CCTGTGAGGGACAGGGTCACAGG - Intronic
1002733452 5:181361413-181361435 CCAGTGAAGGTATGGGTCCCGGG - Intergenic
1003141722 6:3477478-3477500 CCATTGATGGAACGGGGCTCGGG + Intergenic
1004454993 6:15784125-15784147 CCTGTCATGGGATGGGTGGCTGG - Intergenic
1004979754 6:21010462-21010484 CAAGTGATGAAATGGATCTCTGG - Intronic
1009635053 6:66254160-66254182 CCTGTTAGTGAATGAGTCTCAGG - Intergenic
1010351558 6:74881133-74881155 CCAGTGAGGGAATGGGTTTTGGG - Intergenic
1011729473 6:90245911-90245933 CCTGTCATGGAATGAGGGTCTGG - Intronic
1016425564 6:143932980-143933002 CCTGTGATGCAATTTGTCTTCGG + Intronic
1022969693 7:35505633-35505655 GCTGGGATGGAAGGGGCCTCAGG + Intergenic
1031208529 7:118792883-118792905 CCTGTGATGGGAGGGGTTACAGG + Intergenic
1035510066 8:172876-172898 CCAGTGAAGGTATGGGTCCCGGG + Intergenic
1036807462 8:11845407-11845429 CCTGTGATGGGAAGGGTGACCGG - Intronic
1038288439 8:26226960-26226982 CCTTTGAGGTAATGGGTTTCCGG - Intergenic
1038845767 8:31228442-31228464 CCGTAGATAGAATGGGTCTCTGG + Intergenic
1041461956 8:58120872-58120894 TCTGGGAGGGAATGGGCCTCAGG - Intronic
1041541930 8:58994756-58994778 CCTGTGTGGGAATGGGAGTCAGG - Intronic
1045167121 8:99619256-99619278 CCAGGGGTGGAATGGGTCTAAGG - Intronic
1047732972 8:127741542-127741564 CCTCTGTTGAAATGGGTCTGGGG + Intergenic
1049418889 8:142508147-142508169 CCTGGCTTGGGATGGGTCTCAGG - Intronic
1051914986 9:22197999-22198021 CCTGTGATGGGAGGGGCTTCTGG - Intergenic
1053293641 9:36898474-36898496 CCTGTGATGGGAGGGGTTGCTGG - Intronic
1055905754 9:81292119-81292141 CCTGTGATGGAAACTGTCTATGG + Intergenic
1057146422 9:92762302-92762324 CCTGTGTTGGCATGGGTGTGAGG + Intronic
1059849134 9:118317489-118317511 CCTCTGATGGAATAGCTGTCAGG + Intergenic
1060438324 9:123615516-123615538 CCTGTGATGGAAAAGGTAGCAGG - Intronic
1062030499 9:134359906-134359928 CCTGTGAGGGGATGGGGCCCTGG + Intronic
1062407801 9:136405298-136405320 CCTGTGATGGAATGGGTCTCAGG + Intronic
1062757908 9:138314032-138314054 CCAGTGAAGGTATGGGTCCCGGG - Intergenic
1187269962 X:17770932-17770954 CCTGTGTGGAAATGAGTCTCAGG - Intergenic
1187461140 X:19487978-19488000 ACTGTGATGTAATTGGTCTGGGG + Intronic
1187586950 X:20673791-20673813 CCTGTGATGGAATGGCATCCTGG - Intergenic
1187686745 X:21823004-21823026 CCTGTGATGGAATGGCGTCCTGG - Intergenic
1187797281 X:23017889-23017911 CCTCTGAAGTAAGGGGTCTCCGG + Intergenic
1193055965 X:77151274-77151296 CCTGTAGTGGAATGGGCCTTTGG - Intergenic
1193810565 X:86046264-86046286 CCTGGGATGGAATGGGCCTTTGG + Intronic
1194135347 X:90133939-90133961 ACTGTAAAGGAATGGCTCTCGGG - Intergenic
1199134667 X:144235883-144235905 GCTTTCATGGAATGGTTCTCTGG + Intergenic
1199698168 X:150358351-150358373 CCTGTGCTGTGATGGGACTCAGG + Intergenic
1200481127 Y:3704036-3704058 ACTGTAAAGGAATGGCTCTCGGG - Intergenic