ID: 1062410827 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:136423452-136423474 |
| Sequence | GAGCCTGACCACCGCAAGCC AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 93 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 6, 4: 85} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062410826_1062410827 | -2 | Left | 1062410826 | 9:136423431-136423453 | CCGATCAGTGGAGTCAGTATCGA | 0: 1 1: 0 2: 0 3: 3 4: 64 |
||
| Right | 1062410827 | 9:136423452-136423474 | GAGCCTGACCACCGCAAGCCAGG | 0: 1 1: 0 2: 1 3: 6 4: 85 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062410827 | Original CRISPR | GAGCCTGACCACCGCAAGCC AGG | Exonic | ||