ID: 1062410827

View in Genome Browser
Species Human (GRCh38)
Location 9:136423452-136423474
Sequence GAGCCTGACCACCGCAAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062410826_1062410827 -2 Left 1062410826 9:136423431-136423453 CCGATCAGTGGAGTCAGTATCGA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1062410827 9:136423452-136423474 GAGCCTGACCACCGCAAGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062410827 Original CRISPR GAGCCTGACCACCGCAAGCC AGG Exonic