ID: 1062411040

View in Genome Browser
Species Human (GRCh38)
Location 9:136424530-136424552
Sequence TGGACTACAGGCAGCACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062411040_1062411045 8 Left 1062411040 9:136424530-136424552 CCTGCGGTGCTGCCTGTAGTCCA No data
Right 1062411045 9:136424561-136424583 TTCCTACATGTGTGACTCCGTGG No data
1062411040_1062411046 9 Left 1062411040 9:136424530-136424552 CCTGCGGTGCTGCCTGTAGTCCA No data
Right 1062411046 9:136424562-136424584 TCCTACATGTGTGACTCCGTGGG No data
1062411040_1062411049 27 Left 1062411040 9:136424530-136424552 CCTGCGGTGCTGCCTGTAGTCCA No data
Right 1062411049 9:136424580-136424602 GTGGGCTGCACAGAGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062411040 Original CRISPR TGGACTACAGGCAGCACCGC AGG (reversed) Intergenic
No off target data available for this crispr