ID: 1062411045

View in Genome Browser
Species Human (GRCh38)
Location 9:136424561-136424583
Sequence TTCCTACATGTGTGACTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062411038_1062411045 21 Left 1062411038 9:136424517-136424539 CCTGCATGGGCCACCTGCGGTGC No data
Right 1062411045 9:136424561-136424583 TTCCTACATGTGTGACTCCGTGG No data
1062411036_1062411045 29 Left 1062411036 9:136424509-136424531 CCTGGGAACCTGCATGGGCCACC No data
Right 1062411045 9:136424561-136424583 TTCCTACATGTGTGACTCCGTGG No data
1062411040_1062411045 8 Left 1062411040 9:136424530-136424552 CCTGCGGTGCTGCCTGTAGTCCA No data
Right 1062411045 9:136424561-136424583 TTCCTACATGTGTGACTCCGTGG No data
1062411039_1062411045 11 Left 1062411039 9:136424527-136424549 CCACCTGCGGTGCTGCCTGTAGT No data
Right 1062411045 9:136424561-136424583 TTCCTACATGTGTGACTCCGTGG No data
1062411043_1062411045 -4 Left 1062411043 9:136424542-136424564 CCTGTAGTCCAAGGGTAGCTTCC No data
Right 1062411045 9:136424561-136424583 TTCCTACATGTGTGACTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062411045 Original CRISPR TTCCTACATGTGTGACTCCG TGG Intergenic
No off target data available for this crispr