ID: 1062411049

View in Genome Browser
Species Human (GRCh38)
Location 9:136424580-136424602
Sequence GTGGGCTGCACAGAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062411044_1062411049 7 Left 1062411044 9:136424550-136424572 CCAAGGGTAGCTTCCTACATGTG No data
Right 1062411049 9:136424580-136424602 GTGGGCTGCACAGAGCTGTGTGG No data
1062411047_1062411049 -6 Left 1062411047 9:136424563-136424585 CCTACATGTGTGACTCCGTGGGC No data
Right 1062411049 9:136424580-136424602 GTGGGCTGCACAGAGCTGTGTGG No data
1062411040_1062411049 27 Left 1062411040 9:136424530-136424552 CCTGCGGTGCTGCCTGTAGTCCA No data
Right 1062411049 9:136424580-136424602 GTGGGCTGCACAGAGCTGTGTGG No data
1062411043_1062411049 15 Left 1062411043 9:136424542-136424564 CCTGTAGTCCAAGGGTAGCTTCC No data
Right 1062411049 9:136424580-136424602 GTGGGCTGCACAGAGCTGTGTGG No data
1062411039_1062411049 30 Left 1062411039 9:136424527-136424549 CCACCTGCGGTGCTGCCTGTAGT No data
Right 1062411049 9:136424580-136424602 GTGGGCTGCACAGAGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062411049 Original CRISPR GTGGGCTGCACAGAGCTGTG TGG Intergenic
No off target data available for this crispr