ID: 1062411093

View in Genome Browser
Species Human (GRCh38)
Location 9:136424920-136424942
Sequence AACACTAGGATGTTTCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062411093_1062411098 4 Left 1062411093 9:136424920-136424942 CCTGTTAGAAACATCCTAGTGTT No data
Right 1062411098 9:136424947-136424969 ACACCTGGGACAGAAGCTCCCGG No data
1062411093_1062411095 -10 Left 1062411093 9:136424920-136424942 CCTGTTAGAAACATCCTAGTGTT No data
Right 1062411095 9:136424933-136424955 TCCTAGTGTTAACCACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062411093 Original CRISPR AACACTAGGATGTTTCTAAC AGG (reversed) Intergenic
No off target data available for this crispr