ID: 1062411116

View in Genome Browser
Species Human (GRCh38)
Location 9:136425079-136425101
Sequence TCCACCTACCGAGTAGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062411112_1062411116 21 Left 1062411112 9:136425035-136425057 CCTGGGGTTGAGCTTCTGAAGAT No data
Right 1062411116 9:136425079-136425101 TCCACCTACCGAGTAGCCCGAGG No data
1062411114_1062411116 -3 Left 1062411114 9:136425059-136425081 CCGGTGAAGCACAGTCCTGCTCC No data
Right 1062411116 9:136425079-136425101 TCCACCTACCGAGTAGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062411116 Original CRISPR TCCACCTACCGAGTAGCCCG AGG Intergenic
No off target data available for this crispr