ID: 1062411120

View in Genome Browser
Species Human (GRCh38)
Location 9:136425095-136425117
Sequence GCAGTTTCTAGAATGTCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062411120_1062411124 3 Left 1062411120 9:136425095-136425117 CCCGAGGACATTCTAGAAACTGC No data
Right 1062411124 9:136425121-136425143 CAATTAGCCCTCGGTGTCTGTGG No data
1062411120_1062411129 27 Left 1062411120 9:136425095-136425117 CCCGAGGACATTCTAGAAACTGC No data
Right 1062411129 9:136425145-136425167 TTGGAAGCCGAGGCCAACAAAGG No data
1062411120_1062411125 8 Left 1062411120 9:136425095-136425117 CCCGAGGACATTCTAGAAACTGC No data
Right 1062411125 9:136425126-136425148 AGCCCTCGGTGTCTGTGGTTTGG No data
1062411120_1062411128 17 Left 1062411120 9:136425095-136425117 CCCGAGGACATTCTAGAAACTGC No data
Right 1062411128 9:136425135-136425157 TGTCTGTGGTTTGGAAGCCGAGG No data
1062411120_1062411122 -6 Left 1062411120 9:136425095-136425117 CCCGAGGACATTCTAGAAACTGC No data
Right 1062411122 9:136425112-136425134 AACTGCTACCAATTAGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062411120 Original CRISPR GCAGTTTCTAGAATGTCCTC GGG (reversed) Intergenic
No off target data available for this crispr