ID: 1062411424

View in Genome Browser
Species Human (GRCh38)
Location 9:136427103-136427125
Sequence CGCTTTTATGGCTTCTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062411424_1062411428 13 Left 1062411424 9:136427103-136427125 CCTAGGAAGAAGCCATAAAAGCG No data
Right 1062411428 9:136427139-136427161 CCCCATTACCATAAACATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062411424 Original CRISPR CGCTTTTATGGCTTCTTCCT AGG (reversed) Intergenic
No off target data available for this crispr