ID: 1062412856

View in Genome Browser
Species Human (GRCh38)
Location 9:136433582-136433604
Sequence CCGCCCACACAGGTGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062412856_1062412868 15 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412868 9:136433620-136433642 CCCGCCATGACATGGGGGCCCGG No data
1062412856_1062412870 16 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412870 9:136433621-136433643 CCGCCATGACATGGGGGCCCGGG No data
1062412856_1062412872 19 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412872 9:136433624-136433646 CCATGACATGGGGGCCCGGGAGG No data
1062412856_1062412875 27 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412875 9:136433632-136433654 TGGGGGCCCGGGAGGCCTTGGGG No data
1062412856_1062412874 26 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412874 9:136433631-136433653 ATGGGGGCCCGGGAGGCCTTGGG No data
1062412856_1062412873 25 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412873 9:136433630-136433652 CATGGGGGCCCGGGAGGCCTTGG No data
1062412856_1062412866 10 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412866 9:136433615-136433637 CTGTTCCCGCCATGACATGGGGG No data
1062412856_1062412863 7 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412863 9:136433612-136433634 CTGCTGTTCCCGCCATGACATGG No data
1062412856_1062412864 8 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412864 9:136433613-136433635 TGCTGTTCCCGCCATGACATGGG No data
1062412856_1062412865 9 Left 1062412856 9:136433582-136433604 CCCCAGAGCACCTGTGTGGGCGG No data
Right 1062412865 9:136433614-136433636 GCTGTTCCCGCCATGACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062412856 Original CRISPR CCGCCCACACAGGTGCTCTG GGG (reversed) Intronic