ID: 1062415656

View in Genome Browser
Species Human (GRCh38)
Location 9:136448317-136448339
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 11, 1: 4, 2: 6, 3: 49, 4: 443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415645_1062415656 23 Left 1062415645 9:136448271-136448293 CCAGATCCACAGAGACACCAGGA 0: 1
1: 0
2: 1
3: 21
4: 272
Right 1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG 0: 11
1: 4
2: 6
3: 49
4: 443
1062415651_1062415656 6 Left 1062415651 9:136448288-136448310 CCAGGAGAATGGAGGTGGGAGCA 0: 1
1: 2
2: 3
3: 41
4: 361
Right 1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG 0: 11
1: 4
2: 6
3: 49
4: 443
1062415646_1062415656 17 Left 1062415646 9:136448277-136448299 CCACAGAGACACCAGGAGAATGG 0: 1
1: 10
2: 2
3: 35
4: 360
Right 1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG 0: 11
1: 4
2: 6
3: 49
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900347440 1:2216429-2216451 CAGAGACACAAGGACCTTGGAGG - Intergenic
900813857 1:4828314-4828336 CAGTGACCCTAGGAGGATGTTGG + Intergenic
900962612 1:5934816-5934838 CAGAGACACCCAGAGGATCCAGG + Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901501880 1:9657565-9657587 CTGGGACCCCAGGAGGTTGGGGG - Intronic
901632147 1:10653204-10653226 CATAGAAACCAACAGGATGGGGG + Intronic
901917236 1:12509061-12509083 CAGACCCACCAGGAGGAAAGAGG + Exonic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902275576 1:15337121-15337143 CATGGCCACCAGGAGGAAGGGGG + Intronic
902394502 1:16125301-16125323 CAGCGACATCAAGAGGATTGGGG - Exonic
902884868 1:19397536-19397558 AAGAGTCACCAGCTGGATGGTGG + Intronic
903372923 1:22848441-22848463 CTGAGCTACCAGGAGGATGCTGG + Intronic
903697269 1:25217181-25217203 AAGAGACACCAGGAGTGTGAAGG + Intergenic
904417671 1:30373116-30373138 GCCAGTCACCAGGAGGATGGGGG - Intergenic
904424622 1:30415453-30415475 CAGAGCCCCCGGGAGGATGCTGG - Intergenic
904840743 1:33370370-33370392 CAGAGGCACCAGGAGGACAGAGG - Intronic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905771203 1:40639102-40639124 CGGACACACCAGGAGGAAGGAGG + Intronic
905773758 1:40654938-40654960 CCTGGGCACCAGGAGGATGGAGG - Intronic
905833560 1:41095553-41095575 CATAGACCCCAGGAGGTAGGAGG - Intronic
905902756 1:41592634-41592656 CAGAGAAGCCAAGAGGATGGTGG - Intronic
906205157 1:43982584-43982606 CAGAGGGACCTGGAGGATGCAGG + Intronic
906758669 1:48348853-48348875 CAAAGAAGCCAGGAGGATGAAGG - Intronic
907206187 1:52773931-52773953 CAGAGAAACCAGGCCGAGGGTGG - Intronic
907328170 1:53654328-53654350 CACAGAGGCCAGGGGGATGGAGG + Intronic
907462352 1:54612444-54612466 CAGTGCCTCCAGGAGGGTGGGGG + Intronic
908229204 1:62087128-62087150 CACAGACACTTGAAGGATGGTGG + Intronic
910011515 1:82469371-82469393 AAGATTCACCAGGAGGATGTTGG - Intergenic
910098273 1:83548891-83548913 CTAAGACACCAGGAAGATGGTGG + Intergenic
911144377 1:94538583-94538605 CAGAGCCACCTGAGGGATGGTGG + Intronic
912778495 1:112522576-112522598 CACAGGCAGCAGGAGGTTGGGGG + Exonic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915890904 1:159772880-159772902 CAGAGAAATTAAGAGGATGGGGG - Intergenic
917414627 1:174796020-174796042 CAGAGAACCTAGGAGGATAGAGG + Intronic
918180595 1:182083562-182083584 CGGAGACAGCAGGAGGGCGGTGG - Intergenic
918307594 1:183261173-183261195 CAGATGCACTAGCAGGATGGAGG + Intronic
919123776 1:193372368-193372390 TAAAGTCACAAGGAGGATGGGGG - Intergenic
919293638 1:195666273-195666295 CAGAGAGACAAAGAGGAAGGTGG + Intergenic
919773667 1:201179302-201179324 GAGAGTCACATGGAGGATGGAGG - Intergenic
919927786 1:202201327-202201349 AAGAGACATCAGGGTGATGGTGG - Intronic
920167205 1:204044411-204044433 CACAGACCCCAGGAGACTGGAGG - Intergenic
920190078 1:204188200-204188222 CAGAGACCCCAGGAAGAAGTAGG + Intergenic
920844332 1:209581118-209581140 CAGGCACAGGAGGAGGATGGAGG + Intergenic
922188042 1:223293621-223293643 TGGAGACACAAGGAGGATGCTGG + Intronic
922620367 1:226984846-226984868 CAGAGACACCAGGAGAAGTTTGG - Intronic
922994188 1:229943063-229943085 CAGAGAGCCCAGGCGGATAGCGG - Intergenic
923519616 1:234725638-234725660 CAGAGCCACCAGGAGGGTCAAGG + Intergenic
923626168 1:235615735-235615757 AAGAAGCACCAGGAGGAGGGGGG + Intronic
923791871 1:237118525-237118547 CAGAGACAACGGTAGAATGGTGG + Intronic
923942328 1:238842102-238842124 CAGAGATACCTAGAGGATGAAGG - Intergenic
924602928 1:245507318-245507340 CGTAGAAACCAGGAGGATGCAGG + Intronic
924858172 1:247895714-247895736 CCGGGACACCAGGATGATGGTGG - Exonic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1062902039 10:1153903-1153925 CAGAGACACCAGTGGGGTGGGGG - Intergenic
1063738415 10:8789562-8789584 CTGAAACACCATGAGGATAGAGG + Intergenic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065497394 10:26343309-26343331 CACACACACAGGGAGGATGGAGG + Intergenic
1067324660 10:45255984-45256006 CAGACACAGGAGGAGGATGGTGG + Intergenic
1067346344 10:45441563-45441585 TGGAGACATCAGGAGGATGCTGG - Intronic
1068721153 10:60247544-60247566 CGGAGACAAAAGTAGGATGGTGG - Intronic
1070282157 10:75057927-75057949 CCCAGACAGCAGGAGGGTGGAGG - Intronic
1070535232 10:77372226-77372248 GAGTGATTCCAGGAGGATGGGGG - Intronic
1070639527 10:78157671-78157693 CAGGGAGTCCAGGAGGATTGGGG + Intergenic
1070668815 10:78363780-78363802 CAGAGATCCGAGCAGGATGGAGG + Intergenic
1070788588 10:79176512-79176534 CCTTGGCACCAGGAGGATGGAGG - Intronic
1072032666 10:91536499-91536521 CAGAGACACCAGGAGGACCGTGG - Intergenic
1072552040 10:96486643-96486665 CTAAGACAGCAGGAGGATGCTGG - Intronic
1072747855 10:97954116-97954138 CAGAGAGACCAGGAGCCTTGTGG - Intronic
1073148287 10:101294639-101294661 CAGAGAGACCAGGTAGAAGGTGG + Intergenic
1074439551 10:113464132-113464154 CAGAGAACCCAAGAGGAGGGAGG + Intergenic
1074561101 10:114535936-114535958 CAGATTTACCAGGGGGATGGTGG + Intronic
1074609376 10:115006352-115006374 CTGAAACACCAGGAGACTGGCGG + Intergenic
1074715169 10:116211487-116211509 CAGGGACACCATGAGGACAGTGG - Intronic
1074827713 10:117226737-117226759 GAGAGACAAGAGGTGGATGGAGG + Intergenic
1075054533 10:119207629-119207651 CAGAGACACGCGGAGGGTGGGGG + Exonic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1075721753 10:124591447-124591469 CAGAGAAACCAGGAGTCGGGGGG - Intronic
1075794133 10:125106868-125106890 CAGACTCACCAGGAGAATGGAGG + Intronic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076543105 10:131226924-131226946 CAGCGACTCCAGGAGGTGGGAGG - Intronic
1077075933 11:702165-702187 CAGACACACTAGGAGGATGGAGG + Intronic
1077415389 11:2422226-2422248 CAGGGACACCACCAGGTTGGGGG + Exonic
1077481113 11:2815152-2815174 CAGTGACACCCTGAGCATGGGGG - Intronic
1077539833 11:3141322-3141344 CAGAGTCACAGGGAGGATGCTGG - Intronic
1078098494 11:8314846-8314868 GAGAGGCTCCAGGAGGTTGGAGG - Intergenic
1078100221 11:8326000-8326022 CAGCCACCCCAGGAGGATGTAGG - Intergenic
1079093735 11:17497787-17497809 CAGAGAACCCAGGATGAAGGAGG - Intronic
1079503990 11:21133444-21133466 CAGGGACAGCAGGTTGATGGTGG - Intronic
1080225691 11:29957557-29957579 CAGAGACACCAGGAGAAACCGGG - Intergenic
1080706039 11:34694335-34694357 CAAAGACACCAAGAACATGGGGG - Intergenic
1081615372 11:44587655-44587677 CTGAGCCACCAGGTGGGTGGAGG + Intronic
1081759938 11:45570101-45570123 GAGAGACAAGAGGAGGATTGTGG + Intergenic
1081867398 11:46367215-46367237 CAGAGGCCCCAGGAGGTGGGAGG + Intronic
1082982635 11:59137362-59137384 CTGAGGTACCAGGAAGATGGAGG + Intergenic
1083294440 11:61707565-61707587 CAGACACACCAGAAGCATGCAGG + Intronic
1083554938 11:63618601-63618623 CTGAGACCCTAAGAGGATGGAGG + Intergenic
1083678278 11:64340071-64340093 CAGAGATGCTAGGAGGATGCAGG + Intergenic
1084404020 11:68960724-68960746 CACAGGCACCAAGAAGATGGCGG - Intergenic
1084594168 11:70107294-70107316 CAGAGCCACCGGGAGGGTGGTGG + Intronic
1085050224 11:73376577-73376599 CAGAGACACGGGGAGGCAGGGGG - Intronic
1085920359 11:80948035-80948057 GAGTGACACCAAGAAGATGGTGG + Intergenic
1086731709 11:90257764-90257786 TAAAGACATCAGCAGGATGGAGG - Intergenic
1087408513 11:97760541-97760563 CAGGGACTTCAGGAGGATTGTGG + Intergenic
1088734136 11:112712430-112712452 GAGAGACACAAGGAGGAAGATGG + Intergenic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089688135 11:120169799-120169821 CAGATCCATCATGAGGATGGTGG - Exonic
1089980601 11:122768962-122768984 CAGAGCCACCAGGTGCATGGAGG + Intronic
1090167116 11:124561346-124561368 CAGAGACAGCAAGAGAAAGGGGG - Intergenic
1090349802 11:126100787-126100809 CAGAGACACCAGGAGGGAGGGGG + Intergenic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091461578 12:647150-647172 CACAGACACCTGAGGGATGGGGG - Intronic
1092156225 12:6283390-6283412 CAGAGACAGAAGTAGAATGGCGG + Intergenic
1093119148 12:15246513-15246535 CAGAGACATAGGGAGGATGCAGG + Intronic
1093211467 12:16314073-16314095 CAGAGACATCAGGTAAATGGAGG - Intergenic
1093267446 12:17020309-17020331 GAGAGACACAGGGAGGAAGGAGG - Intergenic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1094273990 12:28647958-28647980 AAGAGACACCAGGAGAGTGCAGG - Intergenic
1095454267 12:42365683-42365705 CAAAGTCATCAGGAGAATGGAGG - Intronic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1096478450 12:51922831-51922853 AAGTGCCACCATGAGGATGGTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096571002 12:52523106-52523128 CACAGACACCAGGGAGAGGGTGG + Intergenic
1097872212 12:64610809-64610831 CAGAGACACGTGGAGGCAGGGGG - Intronic
1099632739 12:85171751-85171773 AAGAGACACCAGGAGTGTGTGGG + Intronic
1100585736 12:95977772-95977794 CAGACACTCCAGGAGGAGAGCGG - Intronic
1101144833 12:101830977-101830999 CAGCGCCACCTGGAGGACGGAGG + Intergenic
1102145986 12:110655482-110655504 CAGAGGCCCCACCAGGATGGAGG + Intronic
1102858578 12:116316099-116316121 CAGAGACACCAGGAAGTTGGAGG - Intergenic
1103013647 12:117477181-117477203 CAGAGAAGCCTTGAGGATGGAGG - Intronic
1103434520 12:120914622-120914644 CACAGACACCAACAAGATGGTGG + Intergenic
1104171459 12:126285637-126285659 CTGAGTCACCAGGAAGTTGGTGG + Intergenic
1104689589 12:130815348-130815370 CAGGAACTACAGGAGGATGGAGG - Intronic
1106509002 13:30396949-30396971 TAGAGACAACAGCAGAATGGTGG - Intergenic
1107302042 13:38976221-38976243 CAGGGCCACCAGGAGAATGTGGG - Intronic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1108664693 13:52617756-52617778 CATCGACACCAGGAAGTTGGAGG - Intergenic
1108701501 13:52948023-52948045 CAGAGACACCAGCAGGCGTGGGG + Intergenic
1110882161 13:80585576-80585598 CAGAGAAACAGGGAGGATGCAGG - Intergenic
1112161623 13:96874268-96874290 TAGAGACACCAGGGTGGTGGGGG + Intergenic
1112393786 13:99009688-99009710 CAGACACACAAGCAGGATGGGGG + Intronic
1113048699 13:106184901-106184923 CACTGCAACCAGGAGGATGGGGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113967679 13:114163670-114163692 CAGAGACACTAGGAGACTGTGGG - Intergenic
1114650494 14:24281461-24281483 AGGAGACAGCAGGAGAATGGGGG + Intergenic
1115770534 14:36661312-36661334 CAAAGAAACCAGGAGGTTGCGGG - Intronic
1117656029 14:57957655-57957677 CAGAGACAACCAGAGGATAGAGG + Intronic
1117835636 14:59803021-59803043 CAGTTTCACCAAGAGGATGGTGG - Intronic
1117858518 14:60062758-60062780 CAGGGATGCCAGGAAGATGGGGG - Intronic
1118453002 14:65920976-65920998 CATAGACACAAGGTAGATGGTGG + Intergenic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1122266783 14:100550379-100550401 CAGAGACACCAGGGAGCCGGGGG + Intronic
1122757928 14:103997409-103997431 CTGAGAGACTGGGAGGATGGAGG + Intronic
1123105802 14:105840566-105840588 CAGCCACATCAGGAGGATGTTGG + Intergenic
1202853412 14_GL000225v1_random:36044-36066 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202854517 14_GL000225v1_random:42486-42508 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202855962 14_GL000225v1_random:52511-52533 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202865677 14_GL000225v1_random:115293-115315 CAGAGAGACGAAGAGGAAGGGGG + Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124229425 15:27930683-27930705 CAGAGACTGCCTGAGGATGGAGG + Intronic
1125195901 15:37045642-37045664 CAGAAACACGGGGAGGATGAGGG + Intronic
1128311133 15:66632301-66632323 CAGAGACTGCTGGAGGCTGGGGG + Intronic
1129394278 15:75235713-75235735 CACAGACACCAGGAGCCTGGTGG - Intergenic
1129411665 15:75353891-75353913 CAGAGACCCCAGGAGGCTGATGG + Intronic
1129709286 15:77812286-77812308 CTGAGGCTCCAAGAGGATGGTGG - Intronic
1129790353 15:78336992-78337014 CAGAAACACCACGATGGTGGTGG + Intergenic
1129868052 15:78924061-78924083 CAGAGCCCCCAGGAGGTGGGGGG + Intronic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1130159540 15:81385047-81385069 CAGAGACACCAGGAAGGATGTGG - Intergenic
1130209221 15:81908097-81908119 CAGAGACCCCAGGAAGAGAGAGG - Intergenic
1132631297 16:918923-918945 CAGAGACACCTGTGGGATGTGGG + Intronic
1132842995 16:1987327-1987349 CTGAGACTCCTGGAGGATAGAGG - Exonic
1132984274 16:2756175-2756197 TTGGGAGACCAGGAGGATGGTGG + Intronic
1133024469 16:2981955-2981977 CAGAGACTTGGGGAGGATGGAGG - Intergenic
1133031887 16:3014949-3014971 CAGAGACCTGAGTAGGATGGGGG + Exonic
1133160049 16:3905090-3905112 CAGAAACCCCAGGGGGGTGGTGG - Intergenic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133586774 16:7203341-7203363 CAGAGAGTCAAGGAGAATGGTGG + Intronic
1133973774 16:10585482-10585504 CAGAGTGGCAAGGAGGATGGAGG + Intergenic
1134609058 16:15593357-15593379 CAGGGACACTAGGAGAATTGAGG + Intronic
1134818865 16:17229312-17229334 CACATGCACAAGGAGGATGGAGG - Intronic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135858544 16:26034113-26034135 CAGAGACTCCAGGAAGATCCTGG - Intronic
1137794220 16:51201571-51201593 CAGATATCCCAGGAGGTTGGCGG - Intergenic
1139649877 16:68356870-68356892 CAGAAACACCCAGAGCATGGGGG - Intronic
1139923384 16:70473101-70473123 CTGGACCACCAGGAGGATGGGGG + Exonic
1140209682 16:72960321-72960343 CAGAGACACAGGGCGGAGGGCGG + Intronic
1140270889 16:73465455-73465477 CAGAGGCACCAGGAGGAGACGGG - Intergenic
1141361122 16:83395957-83395979 AACACACACCAGGAGGGTGGAGG - Intronic
1141464831 16:84198543-84198565 CAGAGACAAAAGGGGGTTGGAGG - Intergenic
1142020287 16:87777981-87778003 CAGAGCCACCAGGAAGATCAAGG - Intergenic
1142497699 17:315200-315222 CAGAGACTACAGGTGAATGGAGG - Intronic
1142619170 17:1154169-1154191 CAGGGACACCAGGATCATGAAGG - Intronic
1142873101 17:2834044-2834066 CAAAGACACCAGGCGGGTGCAGG - Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143585836 17:7849773-7849795 CAGAAACATCAGGGTGATGGGGG - Intronic
1144587030 17:16493035-16493057 CAGAGGCACGGGGAGGAAGGTGG - Intergenic
1144613419 17:16745965-16745987 CAAAGACACCATGTGGATGACGG - Intronic
1145133084 17:20376041-20376063 CAAAGACACCATGTGGATGATGG - Intergenic
1145265981 17:21379771-21379793 CAGAGGCACCATGGGGTTGGGGG + Intronic
1146503111 17:33381322-33381344 CTGAGGCACCAAGAGCATGGGGG + Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148677296 17:49452735-49452757 CAGAGAGGCCAAGAGGATGCTGG - Intronic
1148677509 17:49453741-49453763 CAGAGAGGCCAAGAGGATGCTGG - Intronic
1150124944 17:62629423-62629445 CACAGAGACCAGGAGGAGGAGGG - Intronic
1150159195 17:62880537-62880559 CAGGGACCCTAAGAGGATGGGGG + Intergenic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1150885446 17:69080584-69080606 CACAGACACAAGGAGGTTGATGG + Intronic
1151504294 17:74516429-74516451 CTGAGACAAAAGGATGATGGTGG + Intergenic
1151973518 17:77471297-77471319 CAGAGACAGCAGGGGGCTGGAGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152775856 17:82201602-82201624 CAGAGAGGCCAGGAAGGTGGAGG - Exonic
1152887876 17:82863165-82863187 CACAGGCACCACGAGGACGGTGG - Intronic
1154095500 18:11410840-11410862 CAGAGACACTAGGATGATTCTGG - Intergenic
1154395820 18:13987622-13987644 GAGAAAGACCATGAGGATGGAGG + Intergenic
1155029285 18:21969968-21969990 CAGAGACTCGAGGAGGCAGGTGG - Intergenic
1155358791 18:24980000-24980022 AAGAGACACCAGCAGGCTGTGGG + Intergenic
1156293922 18:35773289-35773311 TGGGGACACCTGGAGGATGGAGG - Intergenic
1156519031 18:37705968-37705990 GTGAGACACCAGCAGGATGCTGG + Intergenic
1156801552 18:41120963-41120985 GACAAACACCAGGAGGAAGGAGG + Intergenic
1156885679 18:42132729-42132751 CAGAGACCCTAAGAGGGTGGAGG - Intergenic
1156950849 18:42895910-42895932 GATAGAAACCAGGAAGATGGGGG + Intronic
1157156161 18:45268549-45268571 AAGAGACACCAGGACAAAGGGGG - Intronic
1157156302 18:45269727-45269749 AAGAGACACCAGGATAAAGGGGG + Intronic
1157981249 18:52383690-52383712 CAGAGAAACCAGGAAAATGAAGG - Intronic
1159955499 18:74515851-74515873 CAGAGGCACCAGGAGTAAGAGGG - Intronic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160408589 18:78659777-78659799 CAGGGACAGCTGGGGGATGGTGG - Intergenic
1160541409 18:79625791-79625813 CAGAGACACCTGGAGATTAGGGG + Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160757494 19:765271-765293 CAGAGATCCCAGGCTGATGGAGG + Intergenic
1160974245 19:1784897-1784919 CAGGACCACCAGCAGGATGGAGG + Exonic
1161612096 19:5248806-5248828 CTGAGGCTCCAGGAGGATGGGGG - Intronic
1161739513 19:6012007-6012029 CACAGACAGCATGAGGATGATGG - Intronic
1162044246 19:7988165-7988187 CAGAGCTACCAAGTGGATGGTGG + Intronic
1162341647 19:10094860-10094882 CAGTGACACCAGTAGGATGCTGG - Exonic
1162672142 19:12266298-12266320 GAGAGCCATCAGGAGGATGCTGG - Intronic
1162718872 19:12649995-12650017 CAGCGACACCTGGGGGAAGGAGG - Exonic
1163127279 19:15251154-15251176 CACAGGCAGGAGGAGGATGGCGG - Intronic
1163267867 19:16232559-16232581 TACAGACTCCAGGAGGATGACGG - Intronic
1163731326 19:18951153-18951175 AAAAGTCACCAGGAGGCTGGAGG + Intergenic
1164513534 19:28915838-28915860 CAGAGACCCAAGGAGGCTGAGGG - Intergenic
1164906616 19:31973465-31973487 CAGAGCCATCTGGAGGATGCTGG + Intergenic
1165105600 19:33468126-33468148 CTGAGAGACCTGGAGAATGGAGG + Intronic
1165434079 19:35787308-35787330 CAGAGCCAGCAGGAGTGTGGGGG + Exonic
1165798993 19:38536234-38536256 GGGAGACCCCAGGGGGATGGAGG - Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1166864967 19:45830307-45830329 GAGAGGCAGCAGGGGGATGGGGG - Intronic
1166921265 19:46230587-46230609 CAGGGAGACAAGGAGAATGGGGG - Intronic
1167097209 19:47380893-47380915 CAAAGAGGCCAGGAAGATGGGGG - Exonic
1167102950 19:47415257-47415279 CAAAGACACCAGGTGCAAGGGGG + Intronic
1167409158 19:49334932-49334954 TAGAGACCCCAGGAGGCAGGAGG + Intergenic
925020278 2:563038-563060 CACAGACACCAGGAGAATGGTGG - Intergenic
925585662 2:5461563-5461585 GAGAGTCACCAGGAGGAAAGAGG + Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927249711 2:20986681-20986703 CAGAAACACCACGAGGATCTTGG + Intergenic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928887448 2:36165960-36165982 TAGAGACACAAGTAGAATGGGGG + Intergenic
929030329 2:37644404-37644426 CAGAGATGCCCTGAGGATGGTGG - Exonic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
930122054 2:47768422-47768444 CAGAGGGGCCAGGAGGGTGGTGG - Intronic
934520170 2:95015146-95015168 CAGAGACTCTGGGAGGCTGGAGG - Intergenic
934562189 2:95319194-95319216 CAGAGTCTGCAGGAGGAAGGCGG + Intronic
935347390 2:102121247-102121269 GAGAGAAACCAGGGGGTTGGGGG - Intronic
936047817 2:109200668-109200690 CAGGGACACCAGGAGAAAAGAGG - Intronic
937018517 2:118629382-118629404 CGGGGACTCCAGGAGCATGGAGG + Intergenic
937120497 2:119437250-119437272 GAAAGACACCAGGAGGAGGATGG - Exonic
937864345 2:126736914-126736936 CAGAGACAACTGGGGGATTGAGG + Intergenic
937907488 2:127059298-127059320 GAGAGAGAGCAGGAGGGTGGGGG + Intronic
940515725 2:154681941-154681963 CAGAGACACTAAGTGGATTGAGG - Intergenic
941463284 2:165795061-165795083 CGCAGACTCCAGGAAGATGGTGG + Intergenic
942546556 2:177070675-177070697 CAGACACAAGAGGAGGGTGGTGG - Intergenic
944299274 2:198104194-198104216 CAGGGACTACATGAGGATGGAGG - Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
946764735 2:223030085-223030107 CAGAGAAAGCAGGAGGTAGGGGG + Intergenic
948499770 2:238383231-238383253 CCGAGACACCAAGGAGATGGGGG - Intronic
948631306 2:239304461-239304483 CAGAGCCCCCATGAGGATAGAGG + Intronic
948738840 2:240029800-240029822 CGGAAACACCAGGATGATGAAGG + Exonic
1170327366 20:15171375-15171397 GAGAGACACAAGGAGAAAGGTGG - Intronic
1170374137 20:15681407-15681429 CAAAGACTTCAGCAGGATGGGGG - Intronic
1170931528 20:20773312-20773334 CAGAGACCCCAGGAAGATTTTGG - Intergenic
1171416036 20:24981042-24981064 CAGGCAGACCAGGAGTATGGAGG + Intronic
1172567038 20:35938787-35938809 CACTGACACCAGGAGCAAGGAGG + Exonic
1172778895 20:37424077-37424099 CACAGACTCCAGGAGGACAGAGG + Intergenic
1172811597 20:37652025-37652047 CAGGCCCACCAGGAGAATGGAGG - Intergenic
1172931492 20:38589336-38589358 CAGAGGCTGCAGGATGATGGGGG + Intergenic
1175309183 20:57999537-57999559 CACAGAGAACAGGCGGATGGAGG + Intergenic
1175736155 20:61388688-61388710 CACAGACAGCAGGGGGATGCTGG + Intronic
1175957402 20:62618403-62618425 CCCAGAGACCAGGAGGCTGGAGG + Intergenic
1175968782 20:62673463-62673485 CAGTGACACCCGGAGGAGGCAGG - Intronic
1176271674 20:64238639-64238661 CAGAGACACCAGGAGGGGACGGG - Intronic
1176613459 21:9008022-9008044 CAGAGACACCAATAGGGTTGAGG + Intergenic
1178300725 21:31450555-31450577 CAGAGGCACCAGGGGGACAGGGG + Intronic
1179080961 21:38170333-38170355 CTGAGACAACAGGTGGATGCTGG + Intronic
1179581650 21:42348098-42348120 CAGGGAAACCAGGCAGATGGTGG - Intronic
1180216333 21:46325371-46325393 CAGAGCTCCCAGGAGGGTGGAGG + Intronic
1180852464 22:19028476-19028498 GAGAGCCACCAGGAAAATGGCGG + Intergenic
1181688859 22:24547095-24547117 CAGAGACAGCAGGAGGGCAGAGG + Intronic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1182083183 22:27543518-27543540 CAGAGAAACAGGGAGGAGGGAGG - Intergenic
1182517534 22:30867508-30867530 CAGAGAGATCAGGAGAATGAGGG - Intronic
1183163582 22:36131220-36131242 GTGACAGACCAGGAGGATGGGGG - Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184264939 22:43341964-43341986 CACAGACACAAGGGGGATGATGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184557289 22:45240334-45240356 CAGAGACACGAAGAAGAAGGAGG + Intronic
1184825906 22:46950649-46950671 AAGGAACAACAGGAGGATGGTGG + Intronic
1185342247 22:50296865-50296887 CAGTGACACCAGCAGGGGGGCGG + Intronic
949801985 3:7914252-7914274 CAGACACACCCTGAGGATAGAGG - Intergenic
950634324 3:14304241-14304263 CAGAGTCACAGGGAGGACGGAGG - Intergenic
950686002 3:14619043-14619065 CAAAGACACCAGGAGGAGTGGGG - Intergenic
950977937 3:17269650-17269672 TAGAGACTCCAGAAGGAGGGAGG - Intronic
952207791 3:31197899-31197921 CAGAGACTTGAGGAAGATGGAGG - Intergenic
953957742 3:47244693-47244715 CTGAGACACCAGGGGGAAAGTGG + Intronic
954111414 3:48435429-48435451 CAGAGAGACCTGGAGGATGTAGG - Intronic
955058141 3:55474264-55474286 GAGAGACCCGAGGAGGCTGGAGG + Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
956423082 3:69104831-69104853 CAGACACAATAGGAGGGTGGTGG - Exonic
957959167 3:87227393-87227415 GAGAGACAGCAGGAGGAGGTCGG - Exonic
957987876 3:87594597-87594619 CATATACCCCAGGAGAATGGAGG + Intergenic
959098106 3:101978503-101978525 CAGGGACACTAAGAGGATGGAGG + Intergenic
960524590 3:118695262-118695284 CAGAGACACAAGGAAGAAGCAGG + Intergenic
960811518 3:121631680-121631702 CAGAGACAGCATGGGGAAGGAGG - Exonic
964740015 3:159955241-159955263 CAGACACCCCAGGATGATGGAGG - Intergenic
967266821 3:187698772-187698794 CAGTGCTACGAGGAGGATGGTGG - Exonic
967521226 3:190435278-190435300 TAGAGACACAAGGAGAAGGGTGG - Intronic
968354791 3:198097565-198097587 CAGAAACAACAATAGGATGGTGG + Intergenic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
968614907 4:1573392-1573414 GAGAGAAACCAGGAAGAGGGAGG - Intergenic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
970405302 4:15757335-15757357 CAAAGAACCCAGGAGGGTGGAGG + Intergenic
970620089 4:17809652-17809674 CAAAGAACCTAGGAGGATGGAGG - Intronic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
973116777 4:46470776-46470798 CAGAGACATCATCAGCATGGCGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973821480 4:54665506-54665528 AAGAGACACGAGGAGGATAAAGG + Intronic
974159509 4:58119657-58119679 CAGCGACACCAGGAACAAGGGGG - Intergenic
974202077 4:58655530-58655552 CATAGAAAACAAGAGGATGGAGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975112304 4:70641705-70641727 CAGAAAAATTAGGAGGATGGAGG + Intronic
975837285 4:78437606-78437628 CACAGACACCAAGAGGGCGGGGG - Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
977292927 4:95182519-95182541 GAGAGACAGATGGAGGATGGGGG + Intronic
977607357 4:98996024-98996046 CAGGGACCCCAGGAGGCAGGAGG - Intronic
978610560 4:110534156-110534178 CAAAGAAACCAAGAGGAGGGAGG - Intronic
978652786 4:111027297-111027319 CAGTGACAACAGGAAGAAGGAGG - Intergenic
979160130 4:117449048-117449070 CTGAGCCACCAGGAGGCAGGAGG + Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
979687050 4:123522328-123522350 CAGAGACCCTAGGAGGTTGCGGG + Intergenic
980189269 4:129502587-129502609 AAGAGAAACCAAGAGGTTGGAGG + Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
984559057 4:181246937-181246959 CAGAGAGCAAAGGAGGATGGAGG + Intergenic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
985565040 5:611500-611522 CCTAGACACCAGGAGAAAGGCGG + Intergenic
985923615 5:2998858-2998880 CAGAGACAGCAGGAGGGGAGAGG + Intergenic
986266634 5:6196706-6196728 TAGAGGCAGCAAGAGGATGGCGG + Intergenic
987315059 5:16716377-16716399 CAGGGACACCAAGAGCAGGGAGG + Intronic
987780587 5:22429212-22429234 CAGTGAGCCCAGGAGGGTGGGGG - Intronic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
990951642 5:61304505-61304527 CAAACTCACCAGGAGGATCGTGG + Intergenic
994452009 5:99955326-99955348 CACAGGCACCAGGAACATGGTGG + Intergenic
996220645 5:120928090-120928112 AAAAGCCACCAGGAGGATTGTGG + Intergenic
996650315 5:125867931-125867953 AAGAGACAGCAGGAAGCTGGAGG + Intergenic
996954296 5:129164493-129164515 GAGAGAGGCCAGGAGGATAGGGG + Intergenic
999794569 5:154977009-154977031 CAGAGACAGAAGTAGAATGGTGG - Intergenic
999993432 5:157069390-157069412 CAAACAGACCAGGAGGAGGGAGG - Intergenic
1001667922 5:173448785-173448807 CAGTGACACCAGGAGTTTGGGGG + Intergenic
1002764303 6:226199-226221 CAGAGACACAGGGTGGGTGGGGG - Intergenic
1003315854 6:5011353-5011375 GAGACACAGCAGGAGGAAGGAGG + Intergenic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1007046191 6:38776736-38776758 AAGAGACACCAGATGGATGAAGG + Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007280891 6:40711524-40711546 CAGAAAGCCCAGGAGGATTGAGG + Intergenic
1007682634 6:43645106-43645128 CAGAGACAGCAGGAGGCTGTCGG - Exonic
1008179953 6:48316094-48316116 CAGAGAAACCAAGAGAATGCTGG + Intergenic
1012598306 6:101065653-101065675 CAGACACATCAGGATGATGCTGG - Intergenic
1013285959 6:108681957-108681979 CAGAGGCACTAGTAGCATGGGGG + Exonic
1013692339 6:112660573-112660595 TAGAGACACCAGGTGGCTGGTGG - Intergenic
1013864847 6:114682992-114683014 CTGAGATACCAGAAAGATGGCGG - Intergenic
1015390501 6:132676504-132676526 CTGAGACGCCTGGAGGCTGGAGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016682993 6:146852092-146852114 CTGAGAAACCAAGATGATGGAGG + Intergenic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1017156352 6:151325715-151325737 CAGACACTCCCGGAGGATGGGGG - Intronic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1018894631 6:168005234-168005256 CAGGGACCCTAGGAGGATAGAGG - Intronic
1019860411 7:3653407-3653429 GGGAGAGACCATGAGGATGGGGG + Intronic
1019949420 7:4359301-4359323 CAGAGATGTCAAGAGGATGGAGG + Intergenic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1021034022 7:15774655-15774677 CACAGACACTTGAAGGATGGTGG - Intergenic
1021434636 7:20600308-20600330 CAGAAACCACAGGAGGGTGGGGG + Intergenic
1022381565 7:29865500-29865522 CAGAGACACTAGGGGTATGGAGG + Intronic
1022456807 7:30564832-30564854 TAGAGACACCAGAAGGCTGGTGG + Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022575504 7:31493209-31493231 GAGAGACTCCAGGAGGCAGGAGG - Intergenic
1023382590 7:39623585-39623607 CAGAGCCGCCAGGAGGAGGGTGG + Exonic
1023832875 7:44050304-44050326 CAGGGACACCAGGAGGTAGGAGG + Intronic
1024377530 7:48656321-48656343 CAAAGCCACCTGGAGGATGCTGG - Intergenic
1024693171 7:51825203-51825225 CAGTGACATCAGGAGCATGCTGG - Intergenic
1026653938 7:72240106-72240128 GAGAGACTCCAGGAGTGTGGGGG + Intronic
1028257459 7:88617302-88617324 CAGAGTCATCTGGAAGATGGAGG + Intergenic
1028357080 7:89923523-89923545 CAGGTACAGCAAGAGGATGGTGG - Intergenic
1029524948 7:101088633-101088655 CAGACACCCCACGAGGATGGAGG + Exonic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1029860334 7:103564595-103564617 CAGACACTGCAGGAGAATGGAGG - Intronic
1030187481 7:106777966-106777988 CTGAGAGACCAGGATAATGGAGG + Intergenic
1030195494 7:106849274-106849296 GAAAGACAGCAAGAGGATGGGGG - Intergenic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1030955397 7:115845507-115845529 AAGAGACACCAGTACAATGGTGG + Intergenic
1032436949 7:131908613-131908635 CAGAGACACCAGGTGAAATGAGG + Intergenic
1032442080 7:131949736-131949758 CAGAGACACCTGGAGCCTGGCGG + Intergenic
1032486032 7:132288135-132288157 CAGAGTCACCAGCAGTTTGGGGG - Intronic
1032692419 7:134302068-134302090 CACAGACACCAGGGCAATGGAGG + Exonic
1033537930 7:142329023-142329045 GAGAGACAACATGAGGGTGGGGG - Intergenic
1033537948 7:142329088-142329110 GAGAGACAACATGAGGGTGGGGG - Intergenic
1033797662 7:144866811-144866833 TAGGGACTCCAGAAGGATGGAGG - Intergenic
1034267095 7:149786319-149786341 GAGGGAGACCAGGAGGAGGGAGG - Intergenic
1034563191 7:151894670-151894692 CAGAGAAGCCAGGAGGGCGGAGG - Intergenic
1035228644 7:157447510-157447532 CAGAGACAGAAGTAGAATGGTGG - Intergenic
1035785798 8:2259796-2259818 CAGTCACTCCAGGAAGATGGTGG - Intergenic
1035807009 8:2461920-2461942 CAGTCACTCCAGGAAGATGGTGG + Intergenic
1036656039 8:10678140-10678162 AATAGACATCAGGAGGCTGGGGG + Intronic
1037331549 8:17748365-17748387 CATGGACACCTGAAGGATGGTGG - Intronic
1037758475 8:21726633-21726655 CAGAGACACAAGGAAGAAGATGG - Intronic
1037951104 8:23019263-23019285 AAGAGAGACCAGGCGGCTGGAGG + Intronic
1037952427 8:23027901-23027923 CAGAGACACCCTGAGGAAGGGGG + Intronic
1039178794 8:34839937-34839959 CAGAGAGGCCAGGATGAGGGAGG - Intergenic
1039844927 8:41319245-41319267 CACAGGCGCCAGGAGGGTGGGGG + Intergenic
1039971761 8:42326460-42326482 CAGTGGCACCGGGAGGAGGGTGG - Intronic
1040068837 8:43172723-43172745 CAGAGCCCCCAAGAGCATGGTGG - Intronic
1040535879 8:48309402-48309424 GAGTGACATCAGCAGGATGGAGG + Intergenic
1040854408 8:51933663-51933685 CAGAGACACCAGGAGGGGTCAGG - Intergenic
1040857238 8:51960873-51960895 CTGAGATATTAGGAGGATGGTGG + Intergenic
1041380265 8:57247651-57247673 AGGAGACCCCAGGAGGATGTAGG - Intergenic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1042144543 8:65714391-65714413 CACAGGAACCAGGAAGATGGAGG + Intronic
1042699547 8:71597195-71597217 CACTGAAACCATGAGGATGGGGG + Intergenic
1044869394 8:96603677-96603699 CACAGGCACTGGGAGGATGGAGG - Intronic
1047988726 8:130263511-130263533 GAGAGACACCAGGAGGTGGCTGG + Intronic
1048624592 8:136171520-136171542 CAGAGACACCAGAAGAATCAGGG - Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051679650 9:19594204-19594226 CTGAGACACCAGGAAGAAAGTGG - Intronic
1052337622 9:27336403-27336425 CTGAGACACCAGGAGAAAGGGGG + Intronic
1052381107 9:27772012-27772034 TAGAGACAGCTGGAGGATGGGGG - Intergenic
1055107613 9:72528676-72528698 CAGAACCTTCAGGAGGATGGGGG - Intronic
1055760219 9:79599089-79599111 CAGTGCCAAGAGGAGGATGGAGG + Intronic
1056134514 9:83618837-83618859 CAGAGATAGAAGGAGGATGTGGG - Intergenic
1056798973 9:89678217-89678239 CAGAGACAAAAGGAGGGAGGGGG + Intergenic
1058918218 9:109587874-109587896 CAGAGACTGCAGGAGGAAGGTGG + Intergenic
1059235591 9:112758217-112758239 CAGGGTCTCCAAGAGGATGGGGG - Intronic
1059764180 9:117367832-117367854 CATAGAAACCTGGAGGAAGGAGG + Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060690712 9:125656833-125656855 CAGAGACACAAGAAGGCAGGGGG + Intronic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061380705 9:130255185-130255207 CAGAGACACAAAGAAGCTGGTGG - Intergenic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1062415648 9:136448280-136448302 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415714 9:136448541-136448563 CAGAGACGCCAGGAGGATGGAGG + Intronic
1062415723 9:136448579-136448601 TAGAGACACCAGGATGGAGGTGG + Intronic
1062415731 9:136448612-136448634 CAGACACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415748 9:136448686-136448708 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062569608 9:137179079-137179101 CAGAGCCGCCAGGAGGCCGGCGG - Intronic
1062590335 9:137271799-137271821 CAGGGACAGGAGGAGGGTGGAGG - Intronic
1062631192 9:137463915-137463937 CAGAGACCTCAGAAGGCTGGAGG - Intronic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1062712421 9:137983873-137983895 CAGACACACCAGGAGGACACAGG - Intronic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1062731429 9:138112378-138112400 CAGCTGCACCAGGATGATGGTGG - Exonic
1203738660 Un_GL000216v2:160865-160887 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1186820125 X:13279554-13279576 CAGAGCCACCATGAGGATCTGGG + Intergenic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1190274311 X:48890676-48890698 GAGAGACACCAAGAGGATGCAGG + Intergenic
1190450098 X:50570856-50570878 CAAAGGCACCAGGAGGTTTGGGG - Intergenic
1190485879 X:50924510-50924532 CAGATGAACCTGGAGGATGGAGG - Intergenic
1190887062 X:54539607-54539629 TAGAATCACCTGGAGGATGGGGG + Intronic
1191062779 X:56317625-56317647 TGGAGACATCAGGAAGATGGTGG + Intergenic
1191179929 X:57551130-57551152 CCCAGCTACCAGGAGGATGGAGG + Intergenic
1192319802 X:70081285-70081307 CTAAGGCAACAGGAGGATGGGGG + Intergenic
1194464550 X:94217344-94217366 CAGAAACACCAAAAGTATGGGGG - Intergenic
1195853211 X:109305443-109305465 CACAGACACTTGAAGGATGGTGG + Intergenic
1197035300 X:121866754-121866776 TAGGGACACCAGGAGGATCATGG + Intergenic
1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG + Intronic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1201175500 Y:11306603-11306625 CAGAGACACGAAGATGAAGGGGG - Intergenic
1201177895 Y:11321252-11321274 CAGAGACACGAAGAGGAAGGGGG - Intergenic
1201378082 Y:13343404-13343426 CAGAGTCACCAGGATTATGTAGG - Intronic
1201560398 Y:15310174-15310196 CAGAGAAGCCAGGGTGATGGTGG + Intergenic