ID: 1062415676

View in Genome Browser
Species Human (GRCh38)
Location 9:136448392-136448414
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415663_1062415676 17 Left 1062415663 9:136448352-136448374 CCACAGAGACACCAGGAGGATGG 0: 10
1: 2
2: 1
3: 40
4: 348
Right 1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG No data
1062415671_1062415676 6 Left 1062415671 9:136448363-136448385 CCAGGAGGATGGAGGTGGGGGGC 0: 4
1: 6
2: 7
3: 68
4: 742
Right 1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415676 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr