ID: 1062415687

View in Genome Browser
Species Human (GRCh38)
Location 9:136448429-136448451
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415682_1062415687 6 Left 1062415682 9:136448400-136448422 CCAGGAGGATGGAGGTGGGGGGC 0: 4
1: 6
2: 7
3: 68
4: 742
Right 1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG No data
1062415674_1062415687 17 Left 1062415674 9:136448389-136448411 CCACAGAGACACCAGGAGGATGG 0: 10
1: 2
2: 1
3: 40
4: 348
Right 1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415687 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr