ID: 1062415695

View in Genome Browser
Species Human (GRCh38)
Location 9:136448466-136448488
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415685_1062415695 17 Left 1062415685 9:136448426-136448448 CCACAGAGACACCAGGAGGATGG 0: 10
1: 2
2: 1
3: 40
4: 348
Right 1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG No data
1062415690_1062415695 6 Left 1062415690 9:136448437-136448459 CCAGGAGGATGGAGGTGGGAGCA 0: 2
1: 2
2: 3
3: 68
4: 627
Right 1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415695 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr