ID: 1062415706

View in Genome Browser
Species Human (GRCh38)
Location 9:136448504-136448526
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415693_1062415706 18 Left 1062415693 9:136448463-136448485 CCACAGAGACACCAGGAGGATGG 0: 10
1: 2
2: 1
3: 40
4: 348
Right 1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG No data
1062415701_1062415706 7 Left 1062415701 9:136448474-136448496 CCAGGAGGATGGAGGTGGGGGGC 0: 4
1: 6
2: 7
3: 68
4: 742
Right 1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415706 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr