ID: 1062415740

View in Genome Browser
Species Human (GRCh38)
Location 9:136448650-136448672
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415730_1062415740 16 Left 1062415730 9:136448611-136448633 CCAGACACACCAGGAGGATGGAG 0: 1
1: 1
2: 5
3: 27
4: 332
Right 1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG No data
1062415735_1062415740 7 Left 1062415735 9:136448620-136448642 CCAGGAGGATGGAGGTGGGGAGC 0: 5
1: 5
2: 6
3: 69
4: 550
Right 1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415740 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr