ID: 1062415747

View in Genome Browser
Species Human (GRCh38)
Location 9:136448685-136448707
Sequence CTCCATTCTCCTGGTGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 296}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415747_1062415757 13 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415757 9:136448721-136448743 CCACAGAGACACCAGGAGGATGG No data
1062415747_1062415758 16 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG No data
1062415747_1062415760 20 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415760 9:136448728-136448750 GACACCAGGAGGATGGAGGTGGG No data
1062415747_1062415755 9 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415755 9:136448717-136448739 AGATCCACAGAGACACCAGGAGG No data
1062415747_1062415763 23 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415763 9:136448731-136448753 ACCAGGAGGATGGAGGTGGGGGG No data
1062415747_1062415759 19 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415759 9:136448727-136448749 AGACACCAGGAGGATGGAGGTGG No data
1062415747_1062415761 21 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415761 9:136448729-136448751 ACACCAGGAGGATGGAGGTGGGG No data
1062415747_1062415762 22 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415762 9:136448730-136448752 CACCAGGAGGATGGAGGTGGGGG No data
1062415747_1062415754 6 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415754 9:136448714-136448736 GGCAGATCCACAGAGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415747 Original CRISPR CTCCATTCTCCTGGTGTCTC TGG (reversed) Intronic
900188457 1:1343561-1343583 CTCCACCCTCCTGGCGTCTCAGG + Intronic
900347441 1:2216430-2216452 CTCCAAGGTCCTTGTGTCTCTGG + Intergenic
900458839 1:2790476-2790498 CTCCAGTCTCCAGGTGGCCCTGG + Intronic
902035614 1:13455980-13456002 CTCCATTCCCCTGGTTCCTGAGG - Intergenic
904677390 1:32206732-32206754 CTCCATCCTTGTCGTGTCTCTGG - Exonic
904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG + Intronic
904967325 1:34385544-34385566 CTCTGTGCTCCTTGTGTCTCTGG - Intergenic
905277912 1:36830931-36830953 CTCCAGTCTTCTGGTGTGGCCGG - Intronic
906926791 1:50126299-50126321 CCCCATCCTCTTGGTGTCACAGG + Intronic
907322209 1:53611474-53611496 GTCCTGTCTCCTGGTATCTCTGG + Intronic
908529535 1:65021147-65021169 CTCCATTCTGCTGGGTTCTCTGG - Intergenic
908624515 1:66025673-66025695 CACCATTCTCTGGGTGTCCCAGG + Intronic
909791777 1:79688616-79688638 CTCCATCCTCCTTGTGTCACTGG + Intergenic
909866423 1:80678276-80678298 CTTCATTCACCTGGTTTCTCAGG + Intergenic
910098272 1:83548890-83548912 CACCATCTTCCTGGTGTCTTAGG - Intergenic
910373434 1:86543108-86543130 CTACTTTTTCCTGGTGTCACAGG - Intergenic
911201730 1:95051244-95051266 CTCCATTCTTCCAGTGGCTCAGG + Intronic
912376329 1:109212795-109212817 CTCCAATCACTTGGTCTCTCTGG + Intergenic
914947563 1:152080225-152080247 CTCTAGTCTCCTGGAGACTCAGG - Intergenic
915498045 1:156295007-156295029 CTCCATGTTCCAGGTGTCTCTGG - Exonic
916016282 1:160752607-160752629 CTGCAGTTTCCTGGTGTCTCAGG - Intronic
916119034 1:161511810-161511832 CTGTATTCACCTGGTTTCTCAGG - Intronic
919640700 1:200041462-200041484 CCCCATTCTCCTGCTTGCTCTGG + Intronic
920093795 1:203472622-203472644 CTCTACTCTCCTAGAGTCTCAGG - Intergenic
920223838 1:204423985-204424007 CTCCATTCTCCTGGCCCTTCTGG - Exonic
921841156 1:219830030-219830052 CTCCATTCTCCCAGTTGCTCAGG + Intronic
921993692 1:221394820-221394842 CTCCAGTATCGTGTTGTCTCTGG - Intergenic
923199102 1:231694475-231694497 CTCCCATCTCCTGGGGGCTCTGG - Exonic
923521923 1:234741549-234741571 TTTCATTCTCCTAGTGGCTCAGG - Intergenic
924602927 1:245507317-245507339 CTGCATCCTCCTGGTTTCTACGG - Intronic
924611945 1:245580636-245580658 TTCCACTCTCCTGGTGTCCAGGG - Intronic
1066065964 10:31760991-31761013 CTCAAGTCGCCTGGCGTCTCTGG - Intergenic
1066228708 10:33411083-33411105 CTGCCTTCTCCTCATGTCTCTGG + Intergenic
1066638600 10:37532969-37532991 CACCATTCTGCCGGTTTCTCTGG + Intergenic
1067467080 10:46509116-46509138 CTCCCTTCTCCCAGTGTTTCTGG - Intergenic
1067620106 10:47875489-47875511 CTCCCTTCTCCCAGTGTTTCTGG + Intergenic
1068224701 10:54092136-54092158 CTCCATCCTCCTACTTTCTCAGG + Intronic
1069032080 10:63607681-63607703 TTCTATTCTCCTGGTGTGCCTGG - Intronic
1069806100 10:71125966-71125988 ATCCATTCCCCTGGAGTCACTGG + Intergenic
1070590440 10:77796892-77796914 CTCCATTCTCCTCTGCTCTCTGG + Intronic
1071366983 10:84909445-84909467 CTCCAATTTCCTGGTGGCTAGGG - Intergenic
1071784683 10:88885599-88885621 CTCCATACTCCCAGAGTCTCAGG + Intronic
1072072285 10:91930421-91930443 CTCCATTCTCATGGAGTTTATGG + Intronic
1074609375 10:115006351-115006373 CGCCAGTCTCCTGGTGTTTCAGG - Intergenic
1075405465 10:122192759-122192781 CTCCAGTCTGCTGGTGCTTCAGG + Intronic
1075794132 10:125106867-125106889 CTCCATTCTCCTGGTGAGTCTGG - Intronic
1077245386 11:1534512-1534534 CTCAATTCTCCTGCTGCCTGGGG + Intergenic
1079772582 11:24481145-24481167 CTTCATTCTCCTGTTGTCTATGG - Intergenic
1081383450 11:42443866-42443888 CTCTATTCTCCAGATGTCACTGG - Intergenic
1082640264 11:55651362-55651384 CTCCATTATCCAAGTGGCTCTGG + Exonic
1082982634 11:59137361-59137383 CTCCATCTTCCTGGTACCTCAGG - Intergenic
1084795490 11:71502104-71502126 CTCCACTCCCCTGGAGGCTCTGG - Intronic
1085244307 11:75086863-75086885 CTCCCTTCTCCTAGTCTCCCTGG + Intergenic
1085402788 11:76244554-76244576 CTCCTTTCTCCTGGTTAGTCAGG - Intergenic
1088546302 11:110962781-110962803 TTCCATTCTCCTAGATTCTCTGG - Intergenic
1088612568 11:111591945-111591967 ATCCATTCTCCTTGTTTATCTGG + Intergenic
1090167118 11:124561347-124561369 CCCCTTTCTCTTGCTGTCTCTGG + Intergenic
1093115626 12:15207296-15207318 ATCAATTCTCCTGGTGCATCGGG - Intronic
1093439129 12:19172903-19172925 GATCATTCTCCTCGTGTCTCGGG + Intronic
1096602091 12:52736574-52736596 TTCCATGCTCCTCCTGTCTCCGG + Intergenic
1096770058 12:53929683-53929705 CTGCAGTCTCCTGGCTTCTCTGG - Intergenic
1098273766 12:68793594-68793616 CTCCCTTTTCCTGGTGGCTGAGG - Intronic
1100213263 12:92420393-92420415 CTACATTCTCCTGGAGTCGGTGG - Exonic
1100592647 12:96043895-96043917 CTACATTTTCCTGGTTTATCAGG - Intergenic
1103400445 12:120640257-120640279 CTTCATGCTCCTCGGGTCTCCGG + Intergenic
1103776329 12:123369142-123369164 CTGATTGCTCCTGGTGTCTCAGG - Intergenic
1104770045 12:131355894-131355916 CTTCATTCGCCTGATGTCTGGGG + Intergenic
1104905976 12:132213749-132213771 CTGCATTCTCCAGGTGGCACCGG + Intronic
1105059435 12:133134997-133135019 CTCCATTCTCTTCATGTCTGTGG + Intronic
1105563542 13:21519435-21519457 CTCCATTATCCTGCACTCTCTGG + Intronic
1105991549 13:25627125-25627147 TCTCATTCTCCTGGAGTCTCAGG - Intronic
1106328446 13:28717065-28717087 CACCATTCTCCTGGTCCCTTGGG - Intronic
1106704991 13:32270736-32270758 CTCCCTTCCCCTGGCATCTCGGG + Intronic
1106886657 13:34192550-34192572 CTCCATTCTCCTGCTTTGTGAGG - Intergenic
1107302044 13:38976222-38976244 CCACATTCTCCTGGTGGCCCTGG + Intronic
1109111274 13:58321401-58321423 CACCATTCTCCAGGTTCCTCTGG + Intergenic
1110503990 13:76262946-76262968 CTCAAATCTCCTGATGTCTTTGG - Intergenic
1112704433 13:102050830-102050852 TAGCAGTCTCCTGGTGTCTCAGG - Intronic
1113333363 13:109353796-109353818 CTCCTTTCTCCTGGTTTACCTGG - Intergenic
1114241569 14:20873357-20873379 CACCATTCTGCTGGAGTCACAGG + Intergenic
1114414251 14:22529340-22529362 CCCCGTCCTCCTGGTGTCTACGG - Intergenic
1115349314 14:32376422-32376444 CTCCATTTTCCTGGGGCCACAGG - Intronic
1115572665 14:34681462-34681484 CCCCACTCCCCTGGTTTCTCTGG + Intergenic
1115640379 14:35332015-35332037 CTACATTCCCCTCGTATCTCTGG - Intergenic
1116864089 14:50017348-50017370 CTTCATTCACCTGGTGACTCGGG - Intergenic
1118827787 14:69399384-69399406 CTCCATTAGCCTGCTGTCTCTGG + Exonic
1119565940 14:75629553-75629575 CTACCTTCTCTTTGTGTCTCTGG + Intronic
1119565953 14:75629626-75629648 CTACCTTCTCTTTGTGTCTCTGG + Intronic
1119592823 14:75906099-75906121 TTCCTTTCTCTTGTTGTCTCAGG - Intronic
1120524177 14:85558528-85558550 TTCAATTCTCCTCATGTCTCTGG - Intronic
1121324874 14:93013990-93014012 CTCCTCTCTCCTGGGGCCTCTGG + Intronic
1121644526 14:95508770-95508792 CTCCATTCTCCTGGGTTCTCTGG - Intergenic
1122082106 14:99273487-99273509 CTCCCTTCTCAGGGTTTCTCTGG + Intergenic
1122181563 14:99958780-99958802 CTGCATTCTTCTGGAGGCTCTGG - Intergenic
1122757927 14:103997408-103997430 CTCCATCCTCCCAGTCTCTCAGG - Intronic
1123506299 15:20943027-20943049 CCCCCTTCTCCTGCAGTCTCTGG + Intergenic
1123563525 15:21516731-21516753 CCCCCTTCTCCTGCAGTCTCTGG + Intergenic
1123578897 15:21698513-21698535 CTCATGCCTCCTGGTGTCTCTGG - Intergenic
1123599777 15:21954018-21954040 CCCCCTTCTCCTGCAGTCTCTGG + Intergenic
1123615524 15:22140995-22141017 CTCATGCCTCCTGGTGTCTCTGG - Intergenic
1123882857 15:24691538-24691560 CTCCATTCTCCTGCTTTCCCAGG + Intergenic
1128403955 15:67316029-67316051 CTCCTTTCTCCTTGTGTAGCTGG + Intronic
1128612548 15:69085464-69085486 CTGCATTCCCCTGGTGGCTCTGG - Intergenic
1128649870 15:69402796-69402818 CTCCTTACTCCTGGGGTCTGAGG + Intronic
1128789348 15:70421651-70421673 CTCCCTTTTTCTGGAGTCTCAGG - Intergenic
1130158515 15:81375071-81375093 CTCCATTCTGCTGATGGCTGGGG - Intergenic
1130204971 15:81867329-81867351 TTCCTTTCTCCTCCTGTCTCTGG - Intergenic
1130745425 15:86648435-86648457 CTCCATTCTTCCAGTGGCTCAGG - Intronic
1130808057 15:87347854-87347876 CCCCTTTTTCCTGGTCTCTCAGG - Intergenic
1131109986 15:89758923-89758945 CTTCCTTCTCCTGGGGCCTCTGG - Intergenic
1202971883 15_KI270727v1_random:243868-243890 CCCCCTTCTCCTGCAGTCTCTGG + Intergenic
1202987767 15_KI270727v1_random:432758-432780 CTCATGCCTCCTGGTGTCTCTGG - Intergenic
1132624944 16:887218-887240 TTCTATCCTCCTGGTGTCCCAGG - Intronic
1134609057 16:15593356-15593378 CTCAATTCTCCTAGTGTCCCTGG - Intronic
1134683164 16:16140719-16140741 GTTCATTTTCCTGTTGTCTCTGG + Intronic
1136013209 16:27378188-27378210 CTCTGTCCTCCTGGTGTCTGTGG + Intergenic
1136070299 16:27783348-27783370 CTCCAGTCTCCTAGCCTCTCTGG + Intergenic
1136452741 16:30363130-30363152 CTCCATTCTTCTCATTTCTCAGG + Intronic
1137674048 16:50295072-50295094 CTCCACTCACCTGGTAGCTCAGG + Intronic
1138166051 16:54802629-54802651 CTCCGTTCTCCTTGTCTCTTAGG - Intergenic
1139715858 16:68812626-68812648 TTCCATTCTCATGGTGTTTCTGG + Intronic
1141330557 16:83107255-83107277 GTCCCTTTTCCTGGTTTCTCTGG - Intronic
1141750942 16:85957449-85957471 CTGCATTCTCCTGATGCCCCTGG + Intergenic
1142538091 17:634151-634173 CTCCATATTCTTGGTGACTCTGG + Intronic
1142956903 17:3528726-3528748 GCCCAATCTCCTGGTCTCTCTGG + Intronic
1143757462 17:9077366-9077388 CTCCAATATCCTGTTGCCTCTGG - Intronic
1144372926 17:14610221-14610243 TTCCATTCTCCTGAGGTCCCTGG - Intergenic
1144504458 17:15818156-15818178 CTCCATTCTCCCAATGTCTCGGG + Intergenic
1144634212 17:16893826-16893848 CTCCATTCTCCCAACGTCTCGGG + Intergenic
1144647451 17:16985095-16985117 ATCCATTCTTCTGGTGGCCCAGG + Intergenic
1145168309 17:20633670-20633692 CTCCATTCTCCCAGCGTCTCGGG + Intergenic
1145403628 17:22568317-22568339 CCCCCTTCTCCTGCAGTCTCTGG - Intergenic
1146164402 17:30576635-30576657 CTCCATTCTCCCAACGTCTCGGG + Intergenic
1146270118 17:31479491-31479513 GTCCATGCCCCTGGTGTCTTTGG - Intronic
1147210530 17:38870351-38870373 CTCCATTCTCCTGGGATCGCGGG - Intronic
1147988202 17:44318486-44318508 CTCCATTCTTCTGGTGACCTTGG + Exonic
1148882210 17:50737775-50737797 CTCTCTTCTCCTGGGGTCTATGG - Intronic
1152331492 17:79675754-79675776 CTGCATTCTCCTGATGACTGAGG - Intergenic
1152654124 17:81512222-81512244 ATCCACTCACCTGGTGTCTGGGG + Exonic
1154170205 18:12046073-12046095 CCCCGTTCTCCTGCAGTCTCTGG - Intergenic
1154172617 18:12062166-12062188 CCCCCTTCTCCTGCAGTCTCTGG + Intergenic
1154485450 18:14868314-14868336 CCCCCTTCTCCTGCAGTCTCTGG + Intergenic
1155032095 18:21993684-21993706 CTCCATTCTCCTAGACTCTGAGG + Intergenic
1155317295 18:24584762-24584784 CACCATTTTCCTGGTACCTCTGG - Intergenic
1157767020 18:50307123-50307145 CTCCAGTTTCCTGGTGTGTAGGG + Intergenic
1159317003 18:66788381-66788403 ATCCTGTCTCCTGGTGTCTGTGG + Intergenic
1159489150 18:69107202-69107224 TCCCATTCTCCTGGTGTATGTGG + Intergenic
1160541407 18:79625790-79625812 CCCTAATCTCCAGGTGTCTCTGG - Intergenic
1161772851 19:6240718-6240740 CTGAATTCTCCTGCTGTCTCGGG - Intronic
1162458155 19:10798271-10798293 CTCTGCTCTCCTGCTGTCTCCGG + Intronic
1162838377 19:13336951-13336973 CTGCATTCTGCAGGTGTCACAGG - Intronic
1163049351 19:14670218-14670240 GTCCCTTCACCTGTTGTCTCAGG + Intronic
1163708581 19:18832199-18832221 CTCCACGCTCATGGTGCCTCCGG - Exonic
1164002499 19:21115673-21115695 CTCCATTCTCTTCTTGTCTGTGG + Intronic
1164475151 19:28569902-28569924 CTCCATCCTCCAGGAGTCTCTGG + Intergenic
1165814813 19:38635248-38635270 TTCCATTCACCTTGTGTCTTGGG + Intronic
1167243319 19:48358529-48358551 CTCCATCCTCCAGGAGGCTCAGG + Intronic
1167274305 19:48527264-48527286 CTCATTTCTCTTGGAGTCTCTGG + Intergenic
1167561919 19:50231181-50231203 CTCCTTCCTCCTGGTGGCTCAGG + Intronic
1168428613 19:56258961-56258983 CTCTCTTCTCATGCTGTCTCAGG - Intronic
925119019 2:1403201-1403223 CTCCATTCTTCTGGGGTGTGTGG + Intronic
925540446 2:4960945-4960967 ATCCATTCAACTGGTTTCTCAGG + Intergenic
925563474 2:5224009-5224031 CTCCATTCTCATGCTGTATAAGG + Intergenic
925583285 2:5436408-5436430 CTACATTTTCCTGGTGGCTGTGG + Intergenic
925911323 2:8575332-8575354 CCCCATTCTCTTGGGGTCTGAGG + Intergenic
926123280 2:10256264-10256286 CTGGCTTCTCCTGGTGTCTGCGG - Intergenic
926296995 2:11576340-11576362 CTTCCTTCTCCAGGTTTCTCTGG + Exonic
928774115 2:34737999-34738021 CTCCAATCTCCTAGTCTCTGTGG + Intergenic
928784517 2:34866457-34866479 ATCCATTCTCCTCCTGTCCCAGG - Intergenic
928897501 2:36282058-36282080 CTCCATTTTTCTAGTTTCTCAGG + Intergenic
935227581 2:101067038-101067060 CTCCTCTCTCCTGCTGTTTCTGG + Intronic
935234172 2:101124188-101124210 CTCCTCTCTCCTGCTGTTTCTGG - Intronic
937159049 2:119742805-119742827 TTCTATTTACCTGGTGTCTCAGG + Intergenic
937755631 2:125534739-125534761 CTCTATTCTGCTGGTCTCCCTGG - Intergenic
937999083 2:127718289-127718311 CCCCTTTCTCCAAGTGTCTCAGG + Intronic
938289664 2:130142562-130142584 CCCCATTCTCCATGTCTCTCTGG + Intronic
938908495 2:135862676-135862698 GTCCCTTCTCCTGTTGTCTTTGG + Exonic
940336011 2:152528442-152528464 CTCTTTCCTTCTGGTGTCTCTGG + Intronic
942274819 2:174313074-174313096 CAACATTCTCCTGGAGTCTCTGG + Intergenic
943457914 2:188130377-188130399 CTTCTCTCTCATGGTGTCTCTGG + Intergenic
945431862 2:209773507-209773529 CTCCCTTCCCCTTGTGTCTTTGG - Intronic
946164836 2:217857663-217857685 CTCCAGGCCCCTGGTCTCTCGGG - Intronic
946195363 2:218029378-218029400 CTCCATTTTGATGATGTCTCTGG - Intergenic
946524226 2:220500741-220500763 CTTCAATATCCTTGTGTCTCAGG - Intergenic
946806906 2:223479882-223479904 CACCAGTCTCATGGTGTCTCAGG + Intergenic
947388544 2:229616651-229616673 CTCCACTCTCTGGGTGTCACGGG + Intronic
947595575 2:231409650-231409672 CTCCATTTTCTGGGTGTCCCTGG - Intergenic
948056611 2:235013340-235013362 CCCCCTTCTCCAGTTGTCTCCGG + Intronic
948367865 2:237470088-237470110 CTCCATGTGCCTGGTGTCCCTGG - Intergenic
949038701 2:241834448-241834470 CTCCATTTTTCAGGTTTCTCTGG + Intergenic
1169557992 20:6769267-6769289 CTCCATTCTTCAAGTGTTTCCGG + Intronic
1170644267 20:18182739-18182761 CTCCAAGCTCATTGTGTCTCTGG + Intronic
1172241199 20:33413528-33413550 CCCCTTTCTCCTGGTTTCTAAGG + Intronic
1172473355 20:35217892-35217914 CTCCATTCTTCTAGTTGCTCAGG + Intergenic
1173560321 20:44000421-44000443 CTCCATCCTTCTGGTTGCTCAGG - Intronic
1173890767 20:46508132-46508154 CTCGATTCTCCCGGTGACTCAGG + Intronic
1174142102 20:48422561-48422583 CTCCATTCTCATGGTGAGACTGG + Intergenic
1175391739 20:58631835-58631857 CTCCTTTCTCCTGGGGCCTGGGG - Intergenic
1175531989 20:59680110-59680132 CTCCTGTCTTCTGGTGACTCTGG + Intronic
1175957400 20:62618402-62618424 CTCCAGCCTCCTGGTCTCTGGGG - Intergenic
1176795886 21:13371163-13371185 CCCCCTTCTCCTGCAGTCTCTGG - Intergenic
1176946479 21:14988716-14988738 TTCCATTCTCCTGAGGTCTGTGG - Intronic
1177971829 21:27799349-27799371 CTGCATTCTGTTGGTCTCTCTGG - Intergenic
1178531096 21:33376916-33376938 CTCCCTCCTCCAGGTGCCTCCGG - Intergenic
1179720661 21:43314352-43314374 CTTCCTTCTCCTGGTGTCTGAGG + Intergenic
1180289567 22:10784401-10784423 CCCCTTTCTCCTGTGGTCTCTGG - Intergenic
1180305330 22:11068398-11068420 CCCCCTTCTCCTGTGGTCTCTGG + Intergenic
1181318153 22:21984496-21984518 CTCCATCTTCCTGGTTGCTCAGG + Intergenic
1182128252 22:27832111-27832133 GTCCATTGTGGTGGTGTCTCAGG - Intergenic
1183023542 22:35046604-35046626 CTCCTTTCTCCAGGTTTCTGGGG + Intergenic
1183566492 22:38619185-38619207 CTCCAACCTCCTGGGCTCTCAGG - Intronic
1183832810 22:40427793-40427815 CTCTAATCACTTGGTGTCTCTGG - Intronic
950456490 3:13095749-13095771 CTCCATTGTCCTGCTGCATCTGG - Intergenic
952082553 3:29777917-29777939 ATCCATTCTCCTGGTGGCACAGG - Intronic
953198260 3:40754153-40754175 CTCCACTCTCCAGGAGTTTCTGG - Intergenic
954104840 3:48404341-48404363 TCCCAGTCTCCTGGTGGCTCTGG - Exonic
954398097 3:50303554-50303576 CTCCTTCCTCCAGGAGTCTCTGG - Exonic
954532383 3:51332354-51332376 CCCCATGCTCCTGGTACCTCAGG - Intronic
955914623 3:63894268-63894290 TTCCAAACTCCTGGTTTCTCTGG - Intronic
958039944 3:88215402-88215424 CTCCAATTCCCTGGTCTCTCTGG - Intergenic
959652842 3:108768613-108768635 CTTCATTCTCCAGTGGTCTCAGG - Intergenic
960393758 3:117111351-117111373 CTCCATTTTCTTTGTTTCTCTGG - Intronic
961205328 3:125076836-125076858 ATCCATCCTCATGGGGTCTCTGG + Intergenic
962241424 3:133754175-133754197 CTCCAGTTTCCTGGTGGCTGAGG + Intronic
962401153 3:135059767-135059789 CTCCAACCTCTGGGTGTCTCAGG - Intronic
963228639 3:142888506-142888528 CTCCCCTCTCCTCGTGTCTATGG - Intronic
963474872 3:145792339-145792361 CTTCCTTCTCCTAGTGTCTATGG + Intergenic
964419746 3:156488954-156488976 CTCCATCCTTTTGGTGACTCAGG - Intronic
964740016 3:159955242-159955264 CTCCATCATCCTGGGGTGTCTGG + Intergenic
965697890 3:171428369-171428391 CTCCATTTTTCTGGTTTCTGGGG - Intronic
967288743 3:187898760-187898782 CTCCATTCTGCTGCTGAATCTGG + Intergenic
967330632 3:188285985-188286007 CTCCCTTCTTCTGGTGGCTGAGG + Intronic
967947786 3:194817890-194817912 CTCCATTCTCCTGCTGGCTCTGG - Intergenic
969212960 4:5701781-5701803 CTCCTTTCTCCTATTGGCTCAGG + Intronic
969240691 4:5895061-5895083 CTCCTCTCTCCTTGTGTCCCTGG + Intergenic
970012937 4:11480539-11480561 CTCCATATTCCTGGTTGCTCAGG - Intergenic
970332224 4:14999016-14999038 CTCCATTGTTCTGGTTGCTCAGG - Intergenic
973030330 4:45329892-45329914 CTCCACTCTTCTGTTTTCTCAGG - Intergenic
974506049 4:62773419-62773441 CTCCATCCTTCTGGTTTATCAGG - Intergenic
977494965 4:97763693-97763715 CTCCATGGGCCTGGAGTCTCAGG - Intronic
979451476 4:120876056-120876078 CTTCATTCACCTAGTGTTTCTGG - Intronic
980980877 4:139653731-139653753 AGCCATACTCCTGGTGTCCCTGG + Intergenic
982073954 4:151720123-151720145 CTCCGTGCTGCTGGTCTCTCTGG + Intronic
983751946 4:171284965-171284987 CTCCAATCTCCTTTTATCTCAGG - Intergenic
983871215 4:172826922-172826944 CTCCATTCTCCTCCACTCTCAGG + Intronic
985565038 5:611499-611521 CGCCTTTCTCCTGGTGTCTAGGG - Intergenic
986792975 5:11181358-11181380 CTGCAGTCTCCTGGGGGCTCAGG + Intronic
987188891 5:15452930-15452952 CTCCAGTCTCCTGCTGTTTGAGG + Intergenic
988721436 5:33883051-33883073 CTTTATTCTCCTAGTGTCCCTGG + Intronic
991459711 5:66845022-66845044 CTCCTTTCTTCTTGTGCCTCAGG - Intronic
992458766 5:76940995-76941017 GTCCATTCTCCAGGGTTCTCTGG + Intergenic
992552757 5:77874826-77874848 CTCCATCATCCTGGAGTCCCTGG - Intergenic
993050944 5:82925137-82925159 CTCCAGTTTCCTGCTTTCTCTGG + Intergenic
994045286 5:95302426-95302448 CTCCATCCTTCTAGTTTCTCAGG + Intergenic
994189750 5:96856606-96856628 ATCAATTCTCCTGCTGTTTCTGG + Intronic
999097365 5:148991912-148991934 CTCAACTTTCCTGGTGTCTAAGG + Intronic
1001412757 5:171522450-171522472 CTCCATTTCCCTGCGGTCTCAGG + Intergenic
1001534644 5:172489996-172490018 CTCCATGTTCCTGTTGCCTCAGG - Intergenic
1001667920 5:173448784-173448806 CCCCAAACTCCTGGTGTCACTGG - Intergenic
1002357190 5:178640528-178640550 CTCCATACGCCGGGTGCCTCCGG + Intergenic
1002381071 5:178830750-178830772 CTCTTTTCTCCTGCAGTCTCTGG - Intergenic
1002724231 5:181283749-181283771 CCCCCTTCTCCTGCGGTCTCTGG + Intergenic
1003940646 6:11022042-11022064 CTCCATTCCCCAGGGGTCCCAGG + Intronic
1004275439 6:14231588-14231610 CTTCTTTCTGCTGGTTTCTCTGG - Intergenic
1005581365 6:27238320-27238342 CTTCATTCTCCTGGTACCTCGGG + Intergenic
1006300306 6:33190578-33190600 CTCCACTCTCCTGATTGCTCTGG - Intronic
1006516647 6:34549275-34549297 CACCATTCTGCTCCTGTCTCTGG - Intronic
1007628320 6:43259110-43259132 GTGCATTCTCCTGGTCACTCAGG - Exonic
1010773800 6:79862378-79862400 CTCCAGTCTCCTGCTGGCACTGG - Intergenic
1015390500 6:132676503-132676525 CTCCAGCCTCCAGGCGTCTCAGG - Intergenic
1017284430 6:152658144-152658166 CTACATTCTCCTCGTGTGTCTGG + Intergenic
1018877957 6:167842318-167842340 CTCCATTTTGCTCATGTCTCAGG + Intronic
1020118238 7:5488244-5488266 CTCCATTCACCTGCTGCCTGTGG - Intronic
1020355121 7:7267182-7267204 CTCCATCCTACTGGTTTCTCTGG + Intergenic
1021332440 7:19355197-19355219 TCCCATTGTCCTGGTTTCTCTGG + Intergenic
1021908523 7:25360919-25360941 CTCCCATCTCCTGTTGTCTCAGG + Intergenic
1023899070 7:44461147-44461169 CTCCCTTCTCCTGGCTTCTTCGG + Intronic
1024066546 7:45741603-45741625 CTCCCTACTCCTGGCGTATCTGG + Intergenic
1024974722 7:55102356-55102378 CCACATTCTCCTGGTCTGTCTGG + Intronic
1026347667 7:69488582-69488604 CACCATTCTCCTGGTGGCTCAGG - Intergenic
1029198142 7:98820819-98820841 CTCCACTTTTCTGGTGTCTCAGG + Intergenic
1029371463 7:100153604-100153626 CTACCATCTCCTGGGGTCTCTGG + Intronic
1029524947 7:101088632-101088654 CTCCATCCTCGTGGGGTGTCTGG - Exonic
1029607751 7:101609308-101609330 CTCCTTCCTCCTGGCCTCTCAGG + Intergenic
1030186772 7:106770235-106770257 TTCCATTCTCCTTGATTCTCAGG - Intergenic
1032436948 7:131908612-131908634 CTCATTTCACCTGGTGTCTCTGG - Intergenic
1032461980 7:132118658-132118680 CTCCATCCTCCTTTTGTATCTGG - Intergenic
1032647205 7:133838107-133838129 CTCCATTCTCCCTGTGTAACAGG - Intronic
1032692418 7:134302067-134302089 CTCCATTGCCCTGGTGTCTGTGG - Exonic
1033667317 7:143453941-143453963 CTCCGTTCTTCTAGTTTCTCTGG + Intergenic
1033985550 7:147221485-147221507 GTCCATGCTTCTGCTGTCTCAGG + Intronic
1034005791 7:147470662-147470684 CTCCATTCTTCTGGCTTTTCAGG - Intronic
1036203145 8:6785740-6785762 GTCCATTCTCCTGGTTCCTCTGG - Intergenic
1037585209 8:20271321-20271343 TTCCACTCTCCTGGAGTCTGTGG + Intronic
1037910360 8:22740560-22740582 CCCAATTCCCCTGGGGTCTCTGG + Intronic
1039388976 8:37161931-37161953 CTCCATTCTCCTGGTTTGGAGGG - Intergenic
1041773624 8:61499482-61499504 CTCCCTTCTCCTCATGTTTCAGG - Exonic
1042637293 8:70892739-70892761 CTCTATTCTCTTGCTGTTTCTGG + Intergenic
1043343757 8:79274121-79274143 TTTCATGCTCCTGGTCTCTCTGG - Intergenic
1045395548 8:101757374-101757396 CTCCATTGTCCTTATCTCTCCGG + Intronic
1045725465 8:105168090-105168112 CTGCCTTCTCATGGTGTCTGAGG - Intronic
1046537504 8:115533972-115533994 CTCCAGTCTGATGGTGTTTCGGG - Intronic
1048624594 8:136171521-136171543 CCTGATTCTTCTGGTGTCTCTGG + Intergenic
1048904484 8:139074747-139074769 CTGCATTCTGCAGGTGTCTGAGG - Intergenic
1049170848 8:141159776-141159798 GTCCAATCTCATGGTGGCTCAGG + Intronic
1049439624 8:142603195-142603217 CTCGATTCTCCTGGAATTTCAGG - Intergenic
1050363814 9:4855685-4855707 CCCCATTCTCCCTATGTCTCTGG - Intronic
1051415621 9:16837022-16837044 CCCCACTGTCCTGGTATCTCAGG + Intronic
1051668801 9:19490080-19490102 CTCAATTCTCTTGGTGGCTTTGG + Intergenic
1053886369 9:42647186-42647208 CCCCCTTCTCCTGCGGTCTCTGG + Intergenic
1054225389 9:62454635-62454657 CCCCCTTCTCCTGCGGTCTCTGG + Intergenic
1055495640 9:76851796-76851818 CTCCTATCTCCTGTTTTCTCTGG - Intronic
1055601627 9:77925060-77925082 CTCCATACTGCTGCTCTCTCTGG + Intronic
1056851396 9:90087543-90087565 GGCCTTTCTCCTGGTATCTCAGG - Intergenic
1057390952 9:94641028-94641050 CTGCATTCTTCTAGTTTCTCAGG - Intergenic
1058198457 9:102008560-102008582 CTGCATCCTCCTGTTGTCTTGGG + Intergenic
1059950009 9:119452665-119452687 CTCCATGATCCTGGAGTCTAGGG + Intergenic
1061611524 9:131749786-131749808 CTCCACTCTCCTTGGGTGTCAGG + Intergenic
1061861414 9:133470406-133470428 AACCCTTCTCCTGCTGTCTCTGG - Exonic
1062215788 9:135389166-135389188 CTCCATCCTCCTGATGGGTCTGG - Intergenic
1062415730 9:136448611-136448633 CTCCATCCTCCTGGTGTGTCTGG - Intronic
1062415747 9:136448685-136448707 CTCCATTCTCCTGGTGTCTCTGG - Intronic
1062415785 9:136448835-136448857 CTCCATCCTCCTGGTGTCTCTGG - Intronic
1062676137 9:137745503-137745525 CCCCATTGTCCTGGTGGCTCTGG + Intronic
1188110768 X:26194020-26194042 CTCCATTCCTCAGGAGTCTCAGG + Exonic
1189374646 X:40457398-40457420 CTACATCCTCCTAGTTTCTCTGG - Intergenic
1189943492 X:46152770-46152792 CTCCCCTCTCCTGGTGTCAGTGG - Intergenic
1190706758 X:53035307-53035329 CTCCATTCTTTTGGTTGCTCAGG - Intergenic
1191695374 X:63985026-63985048 ATCCATTCCCCTGGAGTCTTCGG - Intergenic
1193399535 X:81026776-81026798 AACCATCCTTCTGGTGTCTCTGG + Intergenic
1194819241 X:98485875-98485897 CTCCATTCTTCTAGTGGCTTAGG - Intergenic
1194832336 X:98638975-98638997 CTCAATTCTCCTGAAGCCTCAGG + Intergenic
1196570314 X:117259232-117259254 CTCCATTCTCCTTCTGTATTTGG - Intergenic
1197033752 X:121850137-121850159 CTAAATTCTCATGGTGACTCAGG - Intergenic
1198495185 X:137185251-137185273 CTCCATCCTTCTGGTTACTCAGG - Intergenic
1199207428 X:145165188-145165210 GTCTATTCTTCTGGTTTCTCAGG - Intergenic
1200761610 Y:7044102-7044124 CCCCATTCTGCTGTAGTCTCAGG + Intronic
1201599201 Y:15709445-15709467 TTCCATCCTCCTGGTTTCTGGGG + Intergenic