ID: 1062415753

View in Genome Browser
Species Human (GRCh38)
Location 9:136448694-136448716
Sequence GCCCCCGACCTCCATTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 194}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415753_1062415761 12 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415761 9:136448729-136448751 ACACCAGGAGGATGGAGGTGGGG No data
1062415753_1062415759 10 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415759 9:136448727-136448749 AGACACCAGGAGGATGGAGGTGG No data
1062415753_1062415754 -3 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415754 9:136448714-136448736 GGCAGATCCACAGAGACACCAGG No data
1062415753_1062415755 0 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415755 9:136448717-136448739 AGATCCACAGAGACACCAGGAGG No data
1062415753_1062415757 4 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415757 9:136448721-136448743 CCACAGAGACACCAGGAGGATGG No data
1062415753_1062415762 13 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415762 9:136448730-136448752 CACCAGGAGGATGGAGGTGGGGG No data
1062415753_1062415758 7 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG No data
1062415753_1062415763 14 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415763 9:136448731-136448753 ACCAGGAGGATGGAGGTGGGGGG No data
1062415753_1062415760 11 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415760 9:136448728-136448750 GACACCAGGAGGATGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415753 Original CRISPR GCCCCCGACCTCCATTCTCC TGG (reversed) Intronic
900362259 1:2294781-2294803 GCCCCCGTCTGCCAGTCTCCTGG + Intronic
900510931 1:3060791-3060813 GCCCCCGCCCCCCATCCTGCTGG + Intergenic
900541570 1:3205507-3205529 GCCCCCCACCTCTGTTTTCCTGG - Intronic
900582459 1:3415774-3415796 GCCCCCCACCTCCTGGCTCCGGG - Intronic
900659861 1:3776948-3776970 GGTCCCAACCTCCATTCTCTTGG + Intergenic
901190441 1:7406971-7406993 GCCCCCAACCACCTGTCTCCTGG + Intronic
901306775 1:8238728-8238750 CCCCCCAACCCCCATTCACCTGG - Intergenic
901610513 1:10494303-10494325 GCCTGCAGCCTCCATTCTCCCGG - Intronic
902281980 1:15381483-15381505 GGCCCGGGCCTCCCTTCTCCTGG + Intronic
903776959 1:25799810-25799832 GCCCCCGACGCCCCTTCTCCAGG + Intergenic
906874752 1:49525387-49525409 TCCCCCTACCTCTATTCTCATGG - Intronic
909040581 1:70644894-70644916 GCCCCTGACCTCCTTTCTCTTGG + Intergenic
913190347 1:116408025-116408047 CCCCCCGACCTTCATTCACTTGG + Intronic
916557073 1:165902541-165902563 GCCCCAGCCCACCATTCTCTAGG + Intronic
917506997 1:175636460-175636482 GCCCCTGACATCCATGCCCCAGG + Intronic
919258756 1:195161241-195161263 GCCCCTGACCTCTCTTTTCCTGG - Intergenic
920177749 1:204113708-204113730 ACCCCCCACCTCCTTCCTCCAGG - Intronic
921367021 1:214383670-214383692 GCCCCAGATCCCCATGCTCCGGG - Exonic
923045365 1:230351653-230351675 GCCCACGACCTCCTTCTTCCAGG + Intronic
923143385 1:231180580-231180602 ACCCCCTTCCTCCATGCTCCAGG - Intronic
1063464336 10:6233167-6233189 GGCCCCCACCTCCACTCTCTGGG + Exonic
1064970931 10:21066129-21066151 GCCACCTCCCTCCATTCTCATGG + Intronic
1065834831 10:29647215-29647237 GCTCCCGATCTCCCATCTCCAGG + Intronic
1068678401 10:59792591-59792613 GGCCCAGAGCTTCATTCTCCTGG - Exonic
1069589316 10:69631994-69632016 TCCCCAGATCTCCTTTCTCCAGG + Intronic
1069791599 10:71026224-71026246 GTCCCCCACCTCCAGGCTCCAGG + Intergenic
1070496315 10:77027286-77027308 GCCTCTGAGCTCCACTCTCCTGG + Intronic
1071298197 10:84237631-84237653 GCCCCCGGCGTCCATCCCCCCGG - Exonic
1072912993 10:99520373-99520395 GCCCCCGCCCTCCACCCTCTAGG + Intergenic
1073870554 10:107858882-107858904 GCCCCTGACCTCCCTTTTCTTGG - Intergenic
1074666093 10:115727005-115727027 TCCCCTGACCTCCATCCTGCAGG - Intronic
1075794135 10:125106876-125106898 GGTCACGCCCTCCATTCTCCTGG - Intronic
1076187441 10:128460470-128460492 GTCTCAGACCTCCAGTCTCCTGG + Intergenic
1076498069 10:130912256-130912278 CACCCTGACCTCCCTTCTCCGGG + Intergenic
1076546175 10:131246828-131246850 GGCCCCCACCTCTATGCTCCCGG - Intronic
1077366783 11:2164447-2164469 GCCCCTGGCCTCCCCTCTCCTGG - Intronic
1080720055 11:34839937-34839959 GCCCCAAACCTCCATTTTTCTGG - Intergenic
1081574317 11:44309813-44309835 GCGCCCCAGCTCCACTCTCCAGG + Exonic
1081597325 11:44467936-44467958 GCTCCCCACCTCCATGCTTCTGG + Intergenic
1083293918 11:61705125-61705147 GCCCCAGGCCTCCGTTCTCAAGG + Intronic
1083300482 11:61737447-61737469 GCCCCCACCCTCCACCCTCCAGG - Intronic
1083327344 11:61879549-61879571 CCTCCCCACCCCCATTCTCCTGG + Intronic
1084367598 11:68712802-68712824 TCCCCAGACATCCATTCACCTGG - Intronic
1084592818 11:70100253-70100275 GCCCCCGATCCACATGCTCCTGG + Intronic
1084963139 11:72727682-72727704 TCCCCCTACCTCCATGCCCCTGG + Intronic
1086497812 11:87422189-87422211 TGCCCCTACTTCCATTCTCCAGG - Intergenic
1089386898 11:118074445-118074467 GCCCAGAACCCCCATTCTCCCGG - Intergenic
1090255809 11:125283318-125283340 GACCCCAACCTCCATTCTTGAGG - Intronic
1096774896 12:53957699-53957721 GCCCCCCTCCTTCATTCTCACGG - Exonic
1103005438 12:117416851-117416873 GCCCACGCCCTCCATGCGCCAGG + Intronic
1104859934 12:131918565-131918587 GCCCCTGAGCTCCCTGCTCCAGG + Exonic
1104985310 12:132593313-132593335 GTCCCCCATCGCCATTCTCCAGG + Intergenic
1107802295 13:44119949-44119971 GCCCCCGGCCACCATCCTTCAGG - Intergenic
1114651513 14:24287747-24287769 GCCCCCTTCCTCAGTTCTCCAGG + Intergenic
1118317196 14:64732554-64732576 ACCCCCGCCCTCCCTGCTCCTGG - Intronic
1118837150 14:69485285-69485307 GGGCCCCATCTCCATTCTCCCGG - Intronic
1119756732 14:77125079-77125101 GCCTCCGCGCTCCACTCTCCCGG - Intronic
1120787950 14:88554525-88554547 GCCGCCGCGCCCCATTCTCCGGG + Intronic
1121432590 14:93898430-93898452 GCCCTGGACGTCCATCCTCCAGG + Intergenic
1122422134 14:101584260-101584282 GGCCCCGCCCTCCAGCCTCCGGG - Intergenic
1122737234 14:103849723-103849745 GCCCCTGCCCTCCATCTTCCTGG + Intergenic
1123482375 15:20644139-20644161 GCCCCAGACATGCATTGTCCAGG - Intergenic
1123695707 15:22877747-22877769 GCCCCAGGCCTTCATTGTCCTGG - Intronic
1124144531 15:27111840-27111862 ACCCCCAACCTCCATTCCCCAGG + Intronic
1124606098 15:31171363-31171385 GTCTCAGACCTCCAGTCTCCAGG - Intergenic
1127642634 15:60930335-60930357 TCCTCCCACCTCCATTCTCAAGG + Intronic
1128224767 15:65994028-65994050 GCCCCGGACCTCCCATTTCCAGG + Intronic
1128557361 15:68641033-68641055 GCCCCTGACCTCCCTTCCCCTGG + Intronic
1128602763 15:69011596-69011618 GCCCCCCACCTTCTTTCTTCAGG + Intronic
1129325015 15:74795200-74795222 GCCCCAGAGCTCCCTCCTCCAGG + Intronic
1130084341 15:80764688-80764710 CCCCCAGACCTCCCTTCTTCAGG + Intergenic
1132548499 16:544470-544492 GCCCGCGGCCTCCACGCTCCGGG + Intronic
1132981746 16:2741746-2741768 GCCCACAACCTCCACTGTCCTGG + Intergenic
1133887733 16:9846217-9846239 TCCCCCAGCCTCCACTCTCCTGG - Intronic
1140209194 16:72957856-72957878 GCTCCCCCCCTCCATTCTGCAGG + Exonic
1140890436 16:79280269-79280291 GCCCCAGACCTCTCTTCTCCCGG - Intergenic
1142361858 16:89631157-89631179 CCCCCCGGCCTGCCTTCTCCCGG + Intronic
1143078481 17:4365434-4365456 GCCCCCCTCCCCCATTGTCCCGG - Intronic
1143183898 17:4999254-4999276 GCCCACAACCTCCATGCACCAGG - Intronic
1144201135 17:12943686-12943708 ACCCCGGCCCTCCCTTCTCCAGG - Intronic
1144672621 17:17141533-17141555 GCCCTCGCCCTCCTCTCTCCGGG + Intronic
1144849341 17:18236140-18236162 GCCCCCTCCCTGCTTTCTCCCGG + Intronic
1144849976 17:18239128-18239150 GGCCTCAACCTCCCTTCTCCTGG - Intronic
1146005014 17:29155531-29155553 GCCCCCGATCTCATTTCTGCTGG - Intronic
1147210537 17:38870360-38870382 TCGCCCTCCCTCCATTCTCCTGG - Intronic
1151656176 17:75497029-75497051 GCCCCCGAGCTCCCTTGCCCTGG - Intronic
1151801680 17:76383056-76383078 GCCCCCCACCCCCTTGCTCCAGG - Intronic
1152172182 17:78758836-78758858 GCCCCTGACCTCAAGTCTCGTGG - Intronic
1152261492 17:79269674-79269696 ACCCCCCACCTCTTTTCTCCTGG + Intronic
1152834552 17:82520482-82520504 GGCCCCGACCCCCGTCCTCCCGG + Intronic
1156293919 18:35773281-35773303 GCCCTTGGCCTCCATCCTCCAGG + Intergenic
1160671910 19:369346-369368 GCCGCCGTCTTGCATTCTCCGGG - Intronic
1160946130 19:1644849-1644871 GCCGTCCACCCCCATTCTCCTGG - Intronic
1161082470 19:2318030-2318052 CCCCCAGGCCTCCACTCTCCTGG - Intronic
1162018489 19:7858084-7858106 TCCCCCCACCTCCACTCTCTGGG + Intronic
1164157086 19:22603456-22603478 GCCTCCCACCCCCCTTCTCCTGG - Intergenic
1165040485 19:33064725-33064747 GCTCCAGACCTCCTTTCCCCCGG - Intronic
1165105603 19:33468134-33468156 GTTGCCCACCTCCATTCTCCAGG - Intronic
1165256443 19:34579457-34579479 GCCCCCTCCCTCCATCCTTCAGG - Intergenic
1165259155 19:34597948-34597970 GCCCCCTCACTCCATTCTCCAGG - Intronic
1165278112 19:34772555-34772577 GCCCTCGGCCTCCATTCCCTCGG - Intronic
1165357205 19:35311662-35311684 GACCCCCACCTGGATTCTCCAGG - Intronic
1166516959 19:43454299-43454321 TCCTCCTACATCCATTCTCCTGG - Intergenic
1166762157 19:45231822-45231844 GCCCCAGCTCCCCATTCTCCAGG + Exonic
927128511 2:20036198-20036220 GCCCCTGGCCACCTTTCTCCAGG + Intronic
927428779 2:23009033-23009055 GCCCCAGACAGCCATTCTCTTGG + Intergenic
928181780 2:29073111-29073133 GTCACCGACTTCCATTCTTCGGG + Exonic
929565022 2:42978710-42978732 GCCGGCGCCCTCCATTCCCCTGG - Intergenic
934512566 2:94957795-94957817 GCCCCAGACGTGCATTGTCCAGG - Intergenic
934908430 2:98227727-98227749 GCCCTCTCCCTCAATTCTCCAGG - Intronic
935175076 2:100642289-100642311 CCCCCCAACCTCCATCCCCCAGG - Intergenic
936011969 2:108930611-108930633 GACCCCTACCCCCATCCTCCTGG - Intronic
936048461 2:109204576-109204598 GTCCCTGGCCTCCATCCTCCAGG + Intronic
937835046 2:126462902-126462924 GGCCCCAACCCCCATTCTCCAGG - Intergenic
938060766 2:128252648-128252670 GCCCACTACCTACATTCTCATGG - Intronic
938460250 2:131492147-131492169 ACCCCCGACCTCTGCTCTCCGGG - Intronic
941987638 2:171523643-171523665 GCCCCGGGCCTGCATTCTCTGGG + Intronic
946974809 2:225136626-225136648 GCCCCCCACCACCACTCTACAGG - Intergenic
947313252 2:228827068-228827090 GCCCCCTACTTTCATTCTCTTGG - Intergenic
947564291 2:231184191-231184213 GCCCCCGACCTCCCTCCTAGTGG - Intergenic
1168808137 20:684862-684884 GCCCCCTGCCTCCATGCACCTGG - Intergenic
1169433073 20:5556868-5556890 GCCCCTTTCCTCCATCCTCCTGG - Intronic
1171232048 20:23494960-23494982 TCCCCCGCCCTCCATTCTCCAGG + Intronic
1174541865 20:51296139-51296161 CCCCTCCACCTCCCTTCTCCAGG - Intergenic
1175962949 20:62646243-62646265 GCCCAGGACCTCCCTCCTCCAGG - Intronic
1178984895 21:37294797-37294819 GCCCATGAACTACATTCTCCAGG + Intergenic
1179218798 21:39388825-39388847 GCCCCAGCCGTCCACTCTCCAGG - Intronic
1179726315 21:43343377-43343399 GCCACCGCCCTCCCCTCTCCTGG + Intergenic
1180155483 21:45975280-45975302 GGCCCCGCCCTCCACTCTCCAGG - Intergenic
1180960242 22:19759230-19759252 GCCCCCTTCCTCCATTCCCAGGG - Intronic
1181059722 22:20276561-20276583 TCCCACGGCCTCCATTCCCCCGG - Intronic
1181562652 22:23714784-23714806 GCCCCCGATCCCCATACTGCAGG - Intergenic
1181870267 22:25892618-25892640 ACCCCTGATCTCCATTCCCCTGG - Intronic
1182586353 22:31346189-31346211 GCCACCGCCCTCCAGGCTCCGGG - Exonic
1184381153 22:44145574-44145596 GCCCCCAACTTCCATCCTCCAGG - Intronic
1184381366 22:44146892-44146914 CCCCCCAACTTCCATCCTCCAGG - Intronic
1184593716 22:45502446-45502468 GCCACCGACCTGCAGCCTCCCGG + Intronic
1185414575 22:50702939-50702961 GCCCCGCAGCTCCACTCTCCAGG - Intergenic
950008285 3:9705027-9705049 GCCCCCGACCTGGATCCGCCCGG + Intronic
950452999 3:13075962-13075984 GCCCTCGACATCCAATCTCAGGG + Intergenic
952485090 3:33801905-33801927 ATCCCCAACCTCCATTCCCCAGG - Intronic
955059371 3:55482706-55482728 ACCCCAGATTTCCATTCTCCAGG - Intronic
955410041 3:58649386-58649408 GCCCCCAACCTCCATCCTGCAGG - Intronic
958943418 3:100338195-100338217 GCCCCCAACCTCCTTGCTCCAGG + Intronic
959450011 3:106487170-106487192 GCCGCTGACTTCCATTCTTCCGG - Intergenic
961344036 3:126249964-126249986 GACACCGTCCTCCATCCTCCAGG - Intergenic
964307255 3:155355081-155355103 GTCCCTAACCTCCATTCTTCCGG - Intergenic
966305645 3:178531052-178531074 TCCCCTGACCTCCCATCTCCTGG + Intronic
968540432 4:1165543-1165565 GACCCCCAGCTCCATGCTCCAGG + Intergenic
972573282 4:40329749-40329771 GCCCCTGAATTCCCTTCTCCAGG - Intergenic
973567256 4:52200899-52200921 GTCCACCAACTCCATTCTCCAGG - Intergenic
978323120 4:107520096-107520118 ACCTCCAACCTCCAATCTCCTGG - Intergenic
985615552 5:918420-918442 CTCCCCCACCTCCACTCTCCAGG + Intronic
985869880 5:2545796-2545818 GCCACCCACCTCCATTCAGCAGG + Intergenic
997009867 5:129863109-129863131 CCCTCCCACCTCCCTTCTCCAGG - Intergenic
1001174584 5:169455008-169455030 TCCCCCTACCTCAGTTCTCCTGG + Intergenic
1002199753 5:177521106-177521128 GCCCCAGCCTTCCAGTCTCCAGG + Intronic
1002567139 5:180118596-180118618 GGCCCCGACCTACCTTCTCTCGG + Exonic
1002633699 5:180596819-180596841 GCCCCCGTCCTCCCTCCTCATGG + Intergenic
1005926263 6:30448151-30448173 CCCTCCCTCCTCCATTCTCCTGG + Intergenic
1006152423 6:31996587-31996609 ACCCCTCACCTCCAGTCTCCTGG - Exonic
1006158728 6:32029325-32029347 ACCCCTCACCTCCAGTCTCCTGG - Exonic
1006257566 6:32843841-32843863 TGCCCCGACCTGCATTCCCCGGG + Exonic
1006598987 6:35213632-35213654 GCGCCTGACCTCCCTGCTCCCGG + Intergenic
1007072443 6:39047610-39047632 GCCCCTGGCTTCCATTCACCAGG - Intergenic
1008078533 6:47170900-47170922 GCCCCAGACCTCCATACTGGAGG + Intergenic
1008552486 6:52646449-52646471 GCCCCCACCCTCCATTGCCCAGG - Intergenic
1010895031 6:81351513-81351535 GCCGCTGACTTCCATTCTTCCGG + Intergenic
1016391233 6:143578206-143578228 TCCCCAGACCTCCATCCTCACGG + Intronic
1017476707 6:154802012-154802034 GCCCCAGCCTTCCATTCTGCAGG + Exonic
1018350843 6:162957181-162957203 GCCCCACACATCCATTCTCCAGG - Intronic
1018419692 6:163630939-163630961 GCCCCCATCCTCCTCTCTCCGGG + Intergenic
1019356848 7:584744-584766 GCCCCCCACCTCCCTCCTCCCGG + Intronic
1019481360 7:1268365-1268387 GCCCCTCTCCTCCCTTCTCCTGG + Intergenic
1019525081 7:1477198-1477220 GCACCTGCCCTCCCTTCTCCTGG + Intronic
1019587676 7:1814000-1814022 GCCCCTGACCTCCAGCCTCTGGG + Intergenic
1019918401 7:4148042-4148064 GCCCCCATCCTCCATCCTCGTGG + Intronic
1021717328 7:23471369-23471391 GCCCCCGGCCTCATTTATCCTGG - Intergenic
1023221912 7:37928231-37928253 GCCCCTGACCACCATCCTCAAGG - Intronic
1024851877 7:53727799-53727821 ATCCCTGACCTGCATTCTCCTGG - Intergenic
1030324180 7:108202693-108202715 GGACCAGTCCTCCATTCTCCTGG + Intronic
1030747750 7:113188444-113188466 GCCCCTGACCTCCCTTTTCTTGG + Intergenic
1035039421 7:155916692-155916714 GTCCCCAACCTCCATCTTCCAGG - Intergenic
1041741911 8:61165208-61165230 GCCGCTGACTTCCATTCTTCCGG - Intronic
1045017156 8:98009904-98009926 GCCTCTGACCTCCAACCTCCAGG - Intronic
1047209332 8:122828378-122828400 GCACCCTCCCTCCAGTCTCCTGG - Intronic
1049603885 8:143520273-143520295 GCCCCCAACCTGCCCTCTCCCGG - Intronic
1049631981 8:143663807-143663829 CCCCCCCATCTCCATCCTCCTGG + Intergenic
1049738414 8:144222219-144222241 GCCCCCAACCCCCAGCCTCCTGG - Intronic
1050324876 9:4489734-4489756 GCCCCAAGCCTCCATGCTCCAGG + Intergenic
1053221451 9:36316319-36316341 GCCCCTGACTTCCAGTGTCCAGG - Intergenic
1057466194 9:95317003-95317025 GCCCCCAAACCCCATTCGCCGGG - Intronic
1058077991 9:100669898-100669920 GTCCCCGTCCTCAATTTTCCTGG - Intergenic
1059352660 9:113676741-113676763 AGCCCCGACCTACCTTCTCCTGG + Intergenic
1060892461 9:127197490-127197512 GCCCCCCACCCCCATGCTCTGGG - Intronic
1061478862 9:130886518-130886540 GTCCCCTGCCTCCATTCTGCTGG - Intronic
1062109832 9:134776085-134776107 GGCCCCGACTTCCATTTCCCAGG + Intronic
1062415651 9:136448288-136448310 TGCTCCCACCTCCATTCTCCTGG - Intronic
1062415660 9:136448325-136448347 GCTCCCCACCTCCATCCTCCTGG - Intronic
1062415671 9:136448363-136448385 GCCCCCCACCTCCATCCTCCTGG - Intronic
1062415682 9:136448400-136448422 GCCCCCCACCTCCATCCTCCTGG - Intronic
1062415701 9:136448474-136448496 GCCCCCCACCTCCATCCTCCTGG - Intronic
1062415718 9:136448549-136448571 GCTCCCCACCTCCATCCTCCTGG - Intronic
1062415735 9:136448620-136448642 GCTCCCCACCTCCATCCTCCTGG - Intronic
1062415744 9:136448658-136448680 GCTCCCCACCTCCATCCTCCTGG - Intronic
1062415753 9:136448694-136448716 GCCCCCGACCTCCATTCTCCTGG - Intronic
1062415764 9:136448732-136448754 GCCCCCCACCTCCATCCTCCTGG - Intronic
1062415773 9:136448770-136448792 GCTCCCCACCTCCATCCTCCTGG - Intronic
1062415781 9:136448808-136448830 GCTTCCCACCTCCATCCTCCTGG - Intronic
1062415790 9:136448844-136448866 CCCTCCCACCTCCATCCTCCTGG - Intronic
1062444625 9:136588434-136588456 CCCCCCCACCCCCATTCACCAGG + Intergenic
1062482004 9:136756872-136756894 GCCCTCGACCCCCAGGCTCCTGG - Intronic
1062583834 9:137240283-137240305 GGCCCCGACCTCCGGGCTCCAGG - Intergenic
1187707401 X:22022089-22022111 GCCCACGAACTACATTTTCCAGG - Intergenic
1189149104 X:38686320-38686342 ACACCTGAACTCCATTCTCCTGG - Intronic
1190958863 X:55225717-55225739 GCCCCCGACCTCCGTCAGCCAGG + Intronic
1197705965 X:129634611-129634633 GCCCCCGCCCTCCACACTCTGGG - Intergenic
1199432079 X:147773201-147773223 GCCGCTGACTTCCATTCTTCAGG + Intergenic
1199760129 X:150898730-150898752 GCGCCCGACCTCCATCTTCCCGG - Intronic