ID: 1062415758

View in Genome Browser
Species Human (GRCh38)
Location 9:136448724-136448746
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415747_1062415758 16 Left 1062415747 9:136448685-136448707 CCAGAGACACCAGGAGAATGGAG 0: 1
1: 1
2: 5
3: 35
4: 296
Right 1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG No data
1062415753_1062415758 7 Left 1062415753 9:136448694-136448716 CCAGGAGAATGGAGGTCGGGGGC 0: 1
1: 0
2: 5
3: 19
4: 194
Right 1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415758 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr