ID: 1062415769

View in Genome Browser
Species Human (GRCh38)
Location 9:136448762-136448784
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415764_1062415769 7 Left 1062415764 9:136448732-136448754 CCAGGAGGATGGAGGTGGGGGGC 0: 4
1: 6
2: 7
3: 68
4: 742
Right 1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG No data
1062415756_1062415769 18 Left 1062415756 9:136448721-136448743 CCACAGAGACACCAGGAGGATGG 0: 10
1: 2
2: 1
3: 40
4: 348
Right 1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415769 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr