ID: 1062415778

View in Genome Browser
Species Human (GRCh38)
Location 9:136448800-136448822
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415773_1062415778 7 Left 1062415773 9:136448770-136448792 CCAGGAGGATGGAGGTGGGGAGC 0: 5
1: 5
2: 6
3: 69
4: 550
Right 1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG No data
1062415767_1062415778 18 Left 1062415767 9:136448759-136448781 CCACAGAGACACCAGGAGGATGG 0: 10
1: 2
2: 1
3: 40
4: 348
Right 1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415778 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr