ID: 1062415786

View in Genome Browser
Species Human (GRCh38)
Location 9:136448836-136448858
Sequence CAGAGACACCAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062415781_1062415786 5 Left 1062415781 9:136448808-136448830 CCAGGAGGATGGAGGTGGGAAGC 0: 1
1: 5
2: 6
3: 46
4: 436
Right 1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG No data
1062415776_1062415786 16 Left 1062415776 9:136448797-136448819 CCACAGAGACACCAGGAGGATGG 0: 10
1: 2
2: 1
3: 40
4: 348
Right 1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062415786 Original CRISPR CAGAGACACCAGGAGGATGG AGG Intronic
No off target data available for this crispr