ID: 1062416146

View in Genome Browser
Species Human (GRCh38)
Location 9:136451295-136451317
Sequence GGGTCTCTTTGTTTCGGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062416137_1062416146 17 Left 1062416137 9:136451255-136451277 CCTTCTTAGGTTCCTTCGTTTCT 0: 1
1: 0
2: 0
3: 23
4: 659
Right 1062416146 9:136451295-136451317 GGGTCTCTTTGTTTCGGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 107
1062416139_1062416146 5 Left 1062416139 9:136451267-136451289 CCTTCGTTTCTTTCTTGGCTGCC 0: 1
1: 0
2: 2
3: 31
4: 438
Right 1062416146 9:136451295-136451317 GGGTCTCTTTGTTTCGGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062416146 Original CRISPR GGGTCTCTTTGTTTCGGGAG CGG Exonic