ID: 1062416814

View in Genome Browser
Species Human (GRCh38)
Location 9:136455354-136455376
Sequence GTCCATAAATATCCATGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062416814_1062416821 17 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416821 9:136455394-136455416 TCCCCTCCATGGGCTCCTCAGGG 0: 1
1: 0
2: 5
3: 28
4: 279
1062416814_1062416820 16 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416820 9:136455393-136455415 CTCCCCTCCATGGGCTCCTCAGG 0: 1
1: 0
2: 6
3: 26
4: 301
1062416814_1062416817 7 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416817 9:136455384-136455406 GCCATGAGCCTCCCCTCCATGGG 0: 1
1: 0
2: 1
3: 9
4: 140
1062416814_1062416826 21 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416826 9:136455398-136455420 CTCCATGGGCTCCTCAGGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 244
1062416814_1062416816 6 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416816 9:136455383-136455405 AGCCATGAGCCTCCCCTCCATGG 0: 1
1: 0
2: 2
3: 28
4: 282
1062416814_1062416823 18 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416823 9:136455395-136455417 CCCCTCCATGGGCTCCTCAGGGG 0: 1
1: 1
2: 95
3: 356
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062416814 Original CRISPR GTCCATAAATATCCATGTGC TGG (reversed) Intronic