ID: 1062416816

View in Genome Browser
Species Human (GRCh38)
Location 9:136455383-136455405
Sequence AGCCATGAGCCTCCCCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062416814_1062416816 6 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416816 9:136455383-136455405 AGCCATGAGCCTCCCCTCCATGG 0: 1
1: 0
2: 2
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062416816 Original CRISPR AGCCATGAGCCTCCCCTCCA TGG Intronic