ID: 1062416817

View in Genome Browser
Species Human (GRCh38)
Location 9:136455384-136455406
Sequence GCCATGAGCCTCCCCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062416814_1062416817 7 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416817 9:136455384-136455406 GCCATGAGCCTCCCCTCCATGGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062416817 Original CRISPR GCCATGAGCCTCCCCTCCAT GGG Intronic