ID: 1062416820

View in Genome Browser
Species Human (GRCh38)
Location 9:136455393-136455415
Sequence CTCCCCTCCATGGGCTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062416814_1062416820 16 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416820 9:136455393-136455415 CTCCCCTCCATGGGCTCCTCAGG 0: 1
1: 0
2: 6
3: 26
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062416820 Original CRISPR CTCCCCTCCATGGGCTCCTC AGG Intronic