ID: 1062416821

View in Genome Browser
Species Human (GRCh38)
Location 9:136455394-136455416
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062416814_1062416821 17 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416821 9:136455394-136455416 TCCCCTCCATGGGCTCCTCAGGG 0: 1
1: 0
2: 5
3: 28
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type