ID: 1062416821 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:136455394-136455416 |
Sequence | TCCCCTCCATGGGCTCCTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 313 | |||
Summary | {0: 1, 1: 0, 2: 5, 3: 28, 4: 279} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1062416814_1062416821 | 17 | Left | 1062416814 | 9:136455354-136455376 | CCAGCACATGGATATTTATGGAC | No data | ||
Right | 1062416821 | 9:136455394-136455416 | TCCCCTCCATGGGCTCCTCAGGG | 0: 1 1: 0 2: 5 3: 28 4: 279 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1062416821 | Original CRISPR | TCCCCTCCATGGGCTCCTCA GGG | Intronic | ||