ID: 1062416823 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:136455395-136455417 |
| Sequence | CCCCTCCATGGGCTCCTCAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 925 | |||
| Summary | {0: 1, 1: 1, 2: 95, 3: 356, 4: 472} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062416814_1062416823 | 18 | Left | 1062416814 | 9:136455354-136455376 | CCAGCACATGGATATTTATGGAC | No data | ||
| Right | 1062416823 | 9:136455395-136455417 | CCCCTCCATGGGCTCCTCAGGGG | 0: 1 1: 1 2: 95 3: 356 4: 472 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062416823 | Original CRISPR | CCCCTCCATGGGCTCCTCAG GGG | Intronic | ||