ID: 1062416826

View in Genome Browser
Species Human (GRCh38)
Location 9:136455398-136455420
Sequence CTCCATGGGCTCCTCAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062416814_1062416826 21 Left 1062416814 9:136455354-136455376 CCAGCACATGGATATTTATGGAC No data
Right 1062416826 9:136455398-136455420 CTCCATGGGCTCCTCAGGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 244
1062416818_1062416826 -10 Left 1062416818 9:136455385-136455407 CCATGAGCCTCCCCTCCATGGGC 0: 1
1: 0
2: 1
3: 31
4: 293
Right 1062416826 9:136455398-136455420 CTCCATGGGCTCCTCAGGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062416826 Original CRISPR CTCCATGGGCTCCTCAGGGG AGG Intronic