ID: 1062416871

View in Genome Browser
Species Human (GRCh38)
Location 9:136455614-136455636
Sequence AGCACTCGAGCCCGAGCGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062416871_1062416882 25 Left 1062416871 9:136455614-136455636 CCGCACGCTCGGGCTCGAGTGCT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1062416882 9:136455662-136455684 CAGAGGGTTGGCGATCCCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 133
1062416871_1062416876 8 Left 1062416871 9:136455614-136455636 CCGCACGCTCGGGCTCGAGTGCT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1062416876 9:136455645-136455667 GGTGCAGGCACCGCCAGCAGAGG 0: 1
1: 0
2: 0
3: 21
4: 189
1062416871_1062416881 24 Left 1062416871 9:136455614-136455636 CCGCACGCTCGGGCTCGAGTGCT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1062416881 9:136455661-136455683 GCAGAGGGTTGGCGATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1062416871_1062416877 9 Left 1062416871 9:136455614-136455636 CCGCACGCTCGGGCTCGAGTGCT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1062416877 9:136455646-136455668 GTGCAGGCACCGCCAGCAGAGGG 0: 1
1: 0
2: 0
3: 20
4: 147
1062416871_1062416878 13 Left 1062416871 9:136455614-136455636 CCGCACGCTCGGGCTCGAGTGCT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1062416878 9:136455650-136455672 AGGCACCGCCAGCAGAGGGTTGG 0: 1
1: 0
2: 1
3: 26
4: 155
1062416871_1062416875 -7 Left 1062416871 9:136455614-136455636 CCGCACGCTCGGGCTCGAGTGCT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1062416875 9:136455630-136455652 GAGTGCTCAGGGCTCGGTGCAGG 0: 1
1: 0
2: 1
3: 22
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062416871 Original CRISPR AGCACTCGAGCCCGAGCGTG CGG (reversed) Exonic