ID: 1062418222

View in Genome Browser
Species Human (GRCh38)
Location 9:136464673-136464695
Sequence CAGACTTCCAACTCAAAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062418222 Original CRISPR CAGACTTCCAACTCAAAAGT CGG Intronic
903817098 1:26072208-26072230 CATCCTTCCAACTCAAAGGTTGG - Intergenic
904642182 1:31938793-31938815 GGGATTTCCAACTCAGAAGTGGG + Intronic
908698077 1:66867326-66867348 CAGACTTGAAAGTCAAAAGTTGG - Intronic
910533710 1:88271862-88271884 AAGACTTAGAATTCAAAAGTAGG + Intergenic
912788999 1:112632462-112632484 AAGACTTACACATCAAAAGTAGG + Intronic
914830595 1:151168191-151168213 CAGAGGTCAAACTCCAAAGTGGG + Exonic
916515679 1:165514238-165514260 CAGCCTTGCCACTCAAAAGGTGG + Intergenic
919131811 1:193460517-193460539 CAGACTTCCAACTCTATAAGGGG - Intergenic
919548344 1:198951520-198951542 CTGACTTCCAACCCTAAATTCGG + Intergenic
922441141 1:225655879-225655901 CAGCCTGCCAGCTCACAAGTTGG + Intergenic
922779989 1:228244430-228244452 CTGAGCTCCAGCTCAAAAGTGGG + Exonic
923281173 1:232444451-232444473 GGGTCTCCCAACTCAAAAGTCGG - Intronic
924698318 1:246423388-246423410 CAGACTACCATCTCATAAGATGG + Intronic
1064688936 10:17893843-17893865 CAGTATTCAAACCCAAAAGTAGG - Intronic
1066439081 10:35420672-35420694 CAGACTCTCACCTAAAAAGTAGG + Intronic
1069968311 10:72141236-72141258 CTGACTTCTATCTCAAAAGTGGG - Intronic
1070837093 10:79455352-79455374 CAGAGTTGAAACACAAAAGTAGG - Intergenic
1071487992 10:86115625-86115647 CAGAATTCCAACTCAAGCCTGGG + Intronic
1074790419 10:116881059-116881081 AAGATTTCCTACTCTAAAGTGGG - Intronic
1074931951 10:118136715-118136737 AAGACTTCCTAGTCAAAAGCTGG + Intergenic
1075519206 10:123134068-123134090 CAGATTTCCAAAGCAAAAATGGG + Intergenic
1078367073 11:10715640-10715662 CCCAGTTCCAACTCAAAAGATGG + Intergenic
1079466006 11:20731642-20731664 CAGACTTACAATTCACAAGCCGG + Intronic
1086212448 11:84336722-84336744 CAGTCTTCCCACTCTAAAGTAGG + Intronic
1087074442 11:94116197-94116219 CTGACTTCCCTCTCTAAAGTGGG + Intergenic
1087385102 11:97461246-97461268 CACCCTTCCAACTCAGAAGGTGG - Intergenic
1090126842 11:124094976-124094998 CAGTCTTCTAACTTATAAGTGGG - Intergenic
1092523818 12:9297518-9297540 GAGGCTTCCAACTCAAGACTTGG + Intergenic
1092543480 12:9434381-9434403 GAGGCTTCCAACTCAAGACTTGG - Intergenic
1093881259 12:24406581-24406603 CAGTAGTCCAACTCAAAACTGGG + Intergenic
1094004692 12:25737197-25737219 CAGCATACCAACTCAAAAGGGGG - Intergenic
1094460688 12:30694775-30694797 CAGACCTCTTACTAAAAAGTAGG - Intronic
1098777788 12:74643444-74643466 TAAACTTCCATCTCAAAAGGAGG - Intergenic
1109185655 13:59264668-59264690 CAGACTTCCATCTAGAAACTGGG - Intergenic
1110096700 13:71533273-71533295 CTGACTTCCAAATGAAAAATAGG - Intronic
1112085966 13:96033374-96033396 CACCCTACCAACTCAGAAGTGGG - Intronic
1116606314 14:47001027-47001049 CAGACTTCGAACACTAAACTAGG + Intronic
1118099549 14:62581192-62581214 CAGAGATCCAACTTTAAAGTGGG - Intergenic
1120658422 14:87223794-87223816 CACACTTACTACTCAACAGTAGG + Intergenic
1122396881 14:101439904-101439926 CAGACTGCCACCTCGAAAATGGG + Intergenic
1124195639 15:27624610-27624632 CAGACTTCCATAGCAACAGTGGG + Intergenic
1124903519 15:33846514-33846536 GAGACTTCCTACTCAAGAGAAGG - Intronic
1125082579 15:35692762-35692784 AAGACATACAATTCAAAAGTTGG - Intergenic
1126220485 15:46207619-46207641 CACACATCCAACTCATAAGCAGG + Intergenic
1127986412 15:64075527-64075549 TAGATTTCCAACTGGAAAGTGGG + Exonic
1129461127 15:75700546-75700568 CAGACCTCCAAGTCACCAGTGGG - Intronic
1129602191 15:77006296-77006318 AAGACAACCAATTCAAAAGTGGG - Intronic
1145873025 17:28291732-28291754 GAGACTTCCTACTCACAAGGAGG + Intergenic
1147561315 17:41511117-41511139 CAGACTCCCAATTGAAAAGTGGG + Intergenic
1148009000 17:44459585-44459607 GAGACTTCCTACTCACAAGGGGG + Intronic
1149316539 17:55444115-55444137 CAAACTTCCACCTGAAATGTAGG + Intergenic
1149666346 17:58367388-58367410 CAGTTTCCCACCTCAAAAGTGGG - Intronic
1153935126 18:9914318-9914340 CAGACCTCAAATTCAAAGGTAGG + Exonic
1154363796 18:13688186-13688208 CAGGCTTCCTGCTCAAAGGTGGG - Intronic
1155582058 18:27320377-27320399 CAGATTTTCAAGTCAAATGTGGG - Intergenic
1155735219 18:29213397-29213419 AATAATTCCAACTTAAAAGTAGG - Intergenic
1156430329 18:37066167-37066189 CAGACTTACAGCTAAAATGTTGG + Intronic
1156646865 18:39173599-39173621 AACACTTCTACCTCAAAAGTGGG - Intergenic
1162684929 19:12374476-12374498 CAGGCTTCCCACTGAAAAGGAGG - Intergenic
1168467483 19:56615235-56615257 CAGACTTTCCACTCAACAGAAGG - Intronic
926846144 2:17141233-17141255 AAGAGTTCCAAGTGAAAAGTAGG + Intergenic
928937652 2:36696361-36696383 CATATTTTCAATTCAAAAGTGGG + Intergenic
929844486 2:45508525-45508547 AAGTTTTCCAACTCAAAATTAGG + Intronic
930556221 2:52898980-52899002 CAGACTTTCACCTCCACAGTAGG - Intergenic
938569119 2:132546226-132546248 CTGACTTACAACTCTAGAGTGGG - Intronic
941109151 2:161398391-161398413 CAGACTTGAAACTGAAAACTTGG - Intronic
941597039 2:167490291-167490313 CAGACTATCAAATCAAAAATAGG - Intergenic
942094142 2:172522077-172522099 CAGACTTGCAATTAAAGAGTGGG - Intergenic
943427123 2:187750526-187750548 CACACTGCCAACTCAGAAGCGGG + Intergenic
943652228 2:190469596-190469618 CAGACTCCAAACTCAGGAGTGGG - Intronic
1169411329 20:5372796-5372818 CAGATTTCAAACTCAAATGCAGG + Intergenic
1175125244 20:56746638-56746660 CAGATTTCAAAATAAAAAGTTGG + Intergenic
1175684954 20:61022032-61022054 CAGGTTTCCATCTCTAAAGTGGG + Intergenic
1183732343 22:39625719-39625741 CAGACTCCCAACTCCTAATTTGG - Intronic
1183797889 22:40135291-40135313 CAGTCTTCCCACTGAAAGGTGGG - Intronic
1184508221 22:44916986-44917008 CAGACTTCCAAGGCCAAAGGGGG - Intronic
949335841 3:2974497-2974519 CAGACTGCCATCTCTAAAATGGG - Intronic
949487013 3:4549629-4549651 CTGTCTTCCATCTGAAAAGTGGG + Intronic
965026023 3:163303072-163303094 CAGACATCTAATCCAAAAGTAGG + Intergenic
967717541 3:192780014-192780036 CAGCCTTCCAACTCAGTATTTGG - Intergenic
968892413 4:3376566-3376588 CAGACTTGCAGCTCAGAAGTGGG + Intronic
970382465 4:15521887-15521909 CAGAGTGCCAAATCAAAAGTTGG + Intronic
970738247 4:19199163-19199185 GTTACTTCCAACTCAAAGGTGGG + Intergenic
972710814 4:41592712-41592734 CAGATTTCTAACTCATAAGGTGG - Intronic
973998914 4:56490373-56490395 CAAACTTCAAACTCAAATATGGG + Exonic
975398339 4:73903961-73903983 CAGGTTTCCAACTTATAAGTGGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
977072210 4:92405672-92405694 CTGACTCTCAACTGAAAAGTAGG + Intronic
980544667 4:134244149-134244171 CTGACTGCCAACTCAGAAGGGGG - Intergenic
981793862 4:148572337-148572359 TACACTTCCAAATCAAAAATTGG - Intergenic
983382737 4:167018386-167018408 CAGAATTCCAAAACTAAAGTAGG - Intronic
983997025 4:174194765-174194787 CAGAGTTTCAACTCAAAATAAGG - Intergenic
986583998 5:9295364-9295386 CAGAATTCCAACTCACAAAGGGG - Intronic
988578425 5:32447900-32447922 CACACCTACAAGTCAAAAGTAGG + Intergenic
991445700 5:66698108-66698130 CAGACTACATACTCTAAAGTGGG - Intronic
991595138 5:68296548-68296570 TAGTCTTCCAACTAAACAGTAGG - Intronic
992579650 5:78158629-78158651 CAGAATTCAAACTCAGAACTAGG + Intronic
993235563 5:85304454-85304476 CAGATTTCCAAGTAAAATGTAGG - Intergenic
993267959 5:85751773-85751795 CAGACTTCCTACTCAAATCTTGG + Intergenic
997000994 5:129761931-129761953 CAGTGTTCTAACTCATAAGTGGG + Intronic
999835745 5:155369118-155369140 CAGAGATCCAACTGAAAGGTTGG - Intergenic
1004815263 6:19305442-19305464 CATATTTCCTAGTCAAAAGTGGG - Intergenic
1004925533 6:20412054-20412076 CAGACTGTAAACTCAAGAGTGGG - Intronic
1005187848 6:23182996-23183018 AAGCCTTGCAACTCAAAAGGAGG - Intergenic
1008279953 6:49585238-49585260 CAAAATTCCAACTTAAAAGCTGG + Intergenic
1008905195 6:56669700-56669722 CAGACTTGGAACTCAAACCTAGG - Intronic
1009408933 6:63342949-63342971 AAAACTTTCAACTCAAAAGCAGG - Intergenic
1011923482 6:92612478-92612500 CAGACAACCCACTAAAAAGTGGG - Intergenic
1012894513 6:104933209-104933231 CAGATTTTCAATTCACAAGTAGG - Intergenic
1015401233 6:132790683-132790705 CAGTCTTCAAACTCAAGAATAGG + Intronic
1021051052 7:15985401-15985423 CAGACTATTAACTCAAAAGGAGG - Intergenic
1022283548 7:28933942-28933964 CAGACTTCCAGCTAAAAGGTTGG + Intergenic
1022373748 7:29793933-29793955 CAGACTTTCCATTCACAAGTGGG + Intergenic
1027679628 7:81204188-81204210 TAGAATTCCAACTATAAAGTAGG + Intergenic
1030243691 7:107359065-107359087 CACCCCTCCAACTCAGAAGTGGG - Intronic
1031121469 7:117727308-117727330 CAGCCTCCCAACTCAATAGCTGG + Intronic
1035913230 8:3592798-3592820 CAGACTTCCAAATTCACAGTGGG + Intronic
1036499731 8:9302684-9302706 CACACTTCTAACTGAACAGTAGG - Intergenic
1037601123 8:20395074-20395096 CTGATTTCCAACTCAGAAGCTGG - Intergenic
1038192941 8:25340503-25340525 CTGTCCACCAACTCAAAAGTGGG - Intronic
1039322476 8:36447460-36447482 CCAACTTCCAACCCAATAGTAGG + Intergenic
1041683460 8:60618796-60618818 CAGTCATCCAACTGAAAAATTGG + Intronic
1051058966 9:13024068-13024090 AAGACATCCAAGTCAAATGTAGG + Intergenic
1051139503 9:13963468-13963490 GGGACTTCCCACTCAGAAGTGGG + Intergenic
1057619449 9:96621635-96621657 CAGACTTCCTATTCACAAGAAGG - Intergenic
1062418222 9:136464673-136464695 CAGACTTCCAACTCAAAAGTCGG + Intronic
1187589534 X:20701929-20701951 CAGACTTCAAACAAAAAATTAGG + Intergenic
1189880374 X:45485406-45485428 CACACTTCCAAATAACAAGTGGG - Intergenic
1193540144 X:82761254-82761276 CAGAGTTCTCACTCACAAGTGGG - Intergenic
1193866194 X:86733275-86733297 CAGACTTTAAATCCAAAAGTGGG + Intronic
1194782031 X:98035300-98035322 CAGAAATCTAACTCAAAAGTAGG + Intergenic
1196645538 X:118113673-118113695 CTGACTTCCCACACTAAAGTAGG + Intronic
1198579467 X:138048080-138048102 CAGAGTTGGAACTGAAAAGTAGG + Intergenic
1199337195 X:146632057-146632079 CAGACTTCTGACACAAAAGCTGG - Intergenic