ID: 1062419125

View in Genome Browser
Species Human (GRCh38)
Location 9:136470927-136470949
Sequence CGCGCTAGGCTGCGCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062419125_1062419132 8 Left 1062419125 9:136470927-136470949 CCTGGAAGGCGCAGCCTAGCGCG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1062419132 9:136470958-136470980 GACCACGCCCACCCCTCGCAGGG No data
1062419125_1062419131 7 Left 1062419125 9:136470927-136470949 CCTGGAAGGCGCAGCCTAGCGCG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1062419131 9:136470957-136470979 GGACCACGCCCACCCCTCGCAGG No data
1062419125_1062419139 30 Left 1062419125 9:136470927-136470949 CCTGGAAGGCGCAGCCTAGCGCG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1062419139 9:136470980-136471002 GCTCTGCGCACCTCCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062419125 Original CRISPR CGCGCTAGGCTGCGCCTTCC AGG (reversed) Intronic
900629218 1:3624947-3624969 CGCGATTGGCTCCGCCTTGCCGG - Intergenic
901328917 1:8389494-8389516 CGTGCTAGGGTGCGCCTGCTGGG - Intronic
903647647 1:24904714-24904736 GGCGCTGGGCTGGGCCTCCCTGG + Intronic
904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG + Intronic
918259958 1:182786854-182786876 CGCACTATGCTGCCCCCTCCTGG + Intergenic
1063196369 10:3747362-3747384 CGTGCCAGGCTGAGCCTTCCTGG - Intergenic
1064202832 10:13299487-13299509 CGCCCTGGGCAGCGCCTGCCTGG + Intronic
1067246438 10:44550536-44550558 CTTGCTAGGCTGCTCCTTCATGG + Intergenic
1076363257 10:129905016-129905038 AGGGCAAGGCTGCGCCTTTCAGG + Intronic
1077409341 11:2396157-2396179 CGCCCTGTGCTGCGCATTCCGGG + Intronic
1083669509 11:64292191-64292213 CGCGCTTGGCGGCGCGTGCCGGG + Intronic
1085300840 11:75457315-75457337 CTCTCTAGGCTGCCCCTTCCTGG - Intronic
1094753394 12:33439301-33439323 CGCGCTAGGCTGCAAGCTCCGGG - Intronic
1098405092 12:70116612-70116634 CACGCCAAGCTCCGCCTTCCGGG - Intergenic
1105750017 13:23414226-23414248 CACTGTAGGCTCCGCCTTCCGGG - Intronic
1121168954 14:91836731-91836753 CGCGCTTGGCAGCCCCTTCCTGG + Intronic
1121985055 14:98497264-98497286 CTCGCTAGGCTGCAGCTTCCTGG - Intergenic
1122447681 14:101781513-101781535 CTTGCCAGCCTGCGCCTTCCTGG + Intronic
1125541333 15:40471444-40471466 CGCGCCAGGCTGTGCCCTCGCGG - Exonic
1125748996 15:42015847-42015869 CGTGCGAGGCTGCCCCTTCCCGG - Intronic
1132588214 16:715319-715341 CGCGCTGTGCTGCGGCCTCCTGG + Exonic
1132630127 16:913230-913252 CGTGCTGTGCTGGGCCTTCCGGG + Intronic
1133239395 16:4405411-4405433 CCCCCTGGGCTGGGCCTTCCAGG - Intronic
1134441650 16:14302479-14302501 CACCCAGGGCTGCGCCTTCCCGG - Intergenic
1135324959 16:21520394-21520416 CTCGCTCGGCTGCGGCTCCCGGG - Intergenic
1139878884 16:70167755-70167777 CGCGCCCGGCTCCGCCTCCCGGG - Intergenic
1140373634 16:74427738-74427760 CGCGCCCGGCTCCGCCTCCCGGG + Intergenic
1142211899 16:88812368-88812390 CGCCCTGGGCTGCTCCCTCCGGG - Intergenic
1142638302 17:1271026-1271048 CGCGCGAGGCTGGGCCCTGCAGG - Exonic
1148894738 17:50833161-50833183 CGCGCTAGGGAGCTCCCTCCTGG + Intergenic
1151383825 17:73743200-73743222 CGCCCTTGGCTGCCCCTCCCAGG + Intergenic
1152209723 17:78996627-78996649 CACGCTAGGATGTGCCTACCAGG - Intronic
1156036404 18:32771304-32771326 CGCGCTCCGCTGCACTTTCCCGG - Intronic
1160745521 19:709315-709337 CGGGCTGGGCCGCGCCTGCCGGG + Intronic
1160900309 19:1424595-1424617 CACAGTAGGCTGCTCCTTCCGGG + Intronic
1161400779 19:4065654-4065676 TGCGCTAGGCCGCGCATCCCCGG + Intronic
1162373991 19:10294468-10294490 CGCGCTGGCCTGCGCCGCCCGGG + Exonic
1163206550 19:15807605-15807627 CCCGCGGGGCTGCGCCTGCCTGG - Exonic
929765242 2:44838666-44838688 GGCGCCAGGCTTAGCCTTCCTGG + Intergenic
941385048 2:164841839-164841861 CGCGCTGGGCTGAGCCTCGCAGG - Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1175267137 20:57709766-57709788 CGCGCTCCGCTGCGCCCCCCCGG + Exonic
1177894834 21:26845753-26845775 CGCGCTGGGCTGCGGTTCCCAGG + Intergenic
1180039805 21:45269983-45270005 CGCGCTAGGGGGCCCCTACCTGG - Exonic
1181162383 22:20966273-20966295 GGCACTAGGCTGTCCCTTCCTGG - Intronic
1183211584 22:36454849-36454871 CCCGGTGGGCTGCGCCGTCCTGG + Intergenic
1185315472 22:50177126-50177148 CGCGCTGGGCTGGGAGTTCCTGG + Exonic
949344860 3:3067475-3067497 CCCTCTAGACTGCGGCTTCCAGG - Intronic
951613854 3:24521470-24521492 AGCGCTGGGCGGCCCCTTCCGGG - Intergenic
956262851 3:67364053-67364075 CTTGTTAGGCTGCCCCTTCCTGG - Intronic
968640670 4:1712836-1712858 CGCCACAGGCCGCGCCTTCCGGG - Intergenic
982712338 4:158769415-158769437 GGCGATAGGCAGCGCCGTCCTGG - Intronic
986104731 5:4649042-4649064 TGAGCTAGCCTGTGCCTTCCAGG + Intergenic
988496422 5:31749853-31749875 CGCGCGTGGCTTCCCCTTCCCGG + Intronic
998143208 5:139711237-139711259 CGCGCTGGGCTGCGCGCGCCTGG - Intergenic
1004699043 6:18061600-18061622 CGCTCTAAGCTCCGCCTCCCAGG + Intergenic
1011263391 6:85491077-85491099 TGCAGTAGGCTGCTCCTTCCAGG - Intronic
1013491024 6:110646464-110646486 CGAGCTGGGCTCCGCCTTCTGGG - Intronic
1027152055 7:75739567-75739589 CCCGCGGGGCTGCGCTTTCCCGG - Intergenic
1033950768 7:146781595-146781617 CGCGCTGGGCTGCCTCTTACAGG + Intronic
1047704971 8:127488915-127488937 CTTGCTAGGCTGCCCTTTCCTGG + Intergenic
1055266031 9:74497276-74497298 CGGGCTTGGCCGCGACTTCCAGG - Intergenic
1060241356 9:121906513-121906535 CACACTAGGTTTCGCCTTCCAGG - Intronic
1062419125 9:136470927-136470949 CGCGCTAGGCTGCGCCTTCCAGG - Intronic
1062653691 9:137591014-137591036 CGCGGGAGGCCGCGCCCTCCGGG - Intergenic