ID: 1062419328

View in Genome Browser
Species Human (GRCh38)
Location 9:136472111-136472133
Sequence GCCCAAATGCTTCCTCCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062419328_1062419331 29 Left 1062419328 9:136472111-136472133 CCTGTGGGAGGAAGCATTTGGGC 0: 1
1: 0
2: 2
3: 15
4: 185
Right 1062419331 9:136472163-136472185 GTCCAACAGCCAGCCTGAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062419328 Original CRISPR GCCCAAATGCTTCCTCCCAC AGG (reversed) Exonic
902373492 1:16019252-16019274 GCTCCAATGCCTCCTCCCCCAGG + Intronic
902801910 1:18835671-18835693 GGTCAAATGCCTCCTCCCCCGGG - Intergenic
903684114 1:25118784-25118806 GCCCAAAAGCTACCTCCTCCAGG - Intergenic
904710650 1:32427255-32427277 GCCCAAATCCTTCCTCGCTTAGG - Intergenic
906515188 1:46434863-46434885 GCTCAAATGCTGCCTCCTCCAGG - Intergenic
907250241 1:53133312-53133334 GCTGAAATGCTACCTCCCTCAGG - Intronic
907395250 1:54185273-54185295 ACTCAAATGCTTCCTCCCCCAGG - Intronic
907429344 1:54403053-54403075 GCTCCACTGCTTCCTCCCGCTGG + Intronic
908080100 1:60567999-60568021 GACAAAATGCTTCCACACACTGG - Intergenic
908249109 1:62251225-62251247 GCCCAAATCCCAGCTCCCACAGG - Intronic
912466246 1:109876978-109877000 GCTCAAATGCCTCCTCCTCCAGG - Intergenic
912754768 1:112314798-112314820 GCCCAGATGCTCCCTCACTCTGG - Intergenic
917647475 1:177043526-177043548 GCTCATAAGCTTCCTCCAACTGG + Intronic
919610609 1:199741439-199741461 GCCCACATGGCTCCTCCCAGGGG + Intergenic
920218128 1:204375946-204375968 GCTCAAATGCTTCCTCCTCTGGG + Intronic
1062919181 10:1266388-1266410 GAACAAATGCTTCCACCCTCAGG - Intronic
1063367239 10:5498860-5498882 GCGCAAAGCCTTCCTCCCAGGGG + Exonic
1065873838 10:29979983-29980005 GTCCTGATGCTTCCCCCCACTGG - Intergenic
1068232993 10:54195741-54195763 TCCGAAATGGTTGCTCCCACTGG + Exonic
1069081355 10:64091465-64091487 TCCCAAATGCTTCCCTCAACTGG - Intergenic
1070541109 10:77416090-77416112 GCCCAAATGCCTCATTCTACAGG + Intronic
1074919157 10:117989621-117989643 GCCCAAATCTTTCTTCCCAGTGG + Intergenic
1075092914 10:119453481-119453503 GCCCAAATTCACCCTCCCTCTGG + Intronic
1076413048 10:130265358-130265380 GTCCAAATGCTTTCCACCACGGG - Intergenic
1081628632 11:44671899-44671921 GCCCCCATGGTTCCTCTCACGGG - Intergenic
1081960194 11:47130363-47130385 GCCCAAATACTTTACCCCACAGG + Intronic
1082261229 11:50077437-50077459 GCCCAACTCCTGCCTCCCATCGG - Intergenic
1082799896 11:57406728-57406750 GCCCAGAGACTTCCTCCCCCAGG - Intronic
1087477409 11:98653497-98653519 GCCCAATTTCTTCCTCCCTTGGG - Intergenic
1088981898 11:114871602-114871624 GCCGTAATTCTTCCTACCACAGG - Intergenic
1089497117 11:118913538-118913560 CCCCAGCTGCTCCCTCCCACAGG + Intronic
1090346647 11:126076927-126076949 GCCCCATTGCCTCCTCCCTCTGG - Intergenic
1091591379 12:1844911-1844933 CCCCAAATGGTTCCTTCAACAGG + Intronic
1094146933 12:27238505-27238527 CCCCACATGCTTGCTCACACTGG - Intergenic
1099252214 12:80270399-80270421 GCCTAGATGCTGCCTACCACAGG + Intronic
1099887560 12:88550308-88550330 TGCCAATTGCTTCCTCCTACTGG - Intronic
1102158922 12:110753000-110753022 GCCCAAATGCTTCCCCCAGCTGG - Intergenic
1104330271 12:127838153-127838175 GGCCAAATGCATTCTCACACTGG - Intergenic
1105432174 13:20346308-20346330 GCCCTAGAGCTTCCTCCCCCAGG - Intergenic
1105755227 13:23457634-23457656 GCCCCAATGCCTCCTCCCTGAGG - Intergenic
1106098649 13:26674044-26674066 GCCAAACTGGTTCCTCCCCCAGG - Intronic
1107011730 13:35677109-35677131 GCCCCAGTGCTTCCTCCTCCAGG + Intergenic
1107363968 13:39650416-39650438 CACCAAATGGTCCCTCCCACAGG - Intergenic
1110416475 13:75259137-75259159 GCACAACTGCTTCCTCCTGCAGG - Intergenic
1113270546 13:108668879-108668901 GCCAAAATGCTCCCTACTACAGG + Intronic
1113923373 13:113927155-113927177 GGGCCAATGCTTCCCCCCACAGG - Intergenic
1114690454 14:24575410-24575432 TGCCAAATGCTTCCTTCCAGGGG - Exonic
1119879204 14:78086797-78086819 GCCCAATCCCTTCCTCCAACAGG - Intergenic
1119942108 14:78651808-78651830 TCCCACTGGCTTCCTCCCACTGG + Intronic
1121464176 14:94103566-94103588 GCCCCAAGGCTCCATCCCACAGG + Intronic
1122088057 14:99320613-99320635 GCCCAAGCGCTGACTCCCACGGG - Intergenic
1122969959 14:105148497-105148519 GCTCCAGTGCTTCCTCCCCCGGG - Intronic
1123135582 14:106025084-106025106 GCACAGCTGCCTCCTCCCACAGG + Intergenic
1124598621 15:31112560-31112582 GCCCAGCTCCTTCCTCCCAAGGG + Intronic
1127910584 15:63412984-63413006 TCCCAAATCCATCCTCCCAAAGG - Intergenic
1128729900 15:70014093-70014115 GGGCAAATGCTTCCTCCCTGCGG + Intergenic
1129754809 15:78091662-78091684 GCTCCAAAGCTTCCTACCACAGG + Intronic
1131377088 15:91934424-91934446 GCCAAAATGCTTCTTTGCACCGG + Intronic
1131524735 15:93143740-93143762 GCCCCAGTGCTTCCTCCTCCAGG - Intergenic
1135340938 16:21647492-21647514 ACTCATCTGCTTCCTCCCACAGG - Exonic
1138314405 16:56056491-56056513 GTCCACATGCTTCGTCACACAGG + Intergenic
1138317917 16:56086274-56086296 GCTCAAATGCTGCCTCCCACAGG - Intergenic
1139878078 16:70162640-70162662 CCCCAAATCCTCCCTCACACTGG - Intergenic
1142201698 16:88764103-88764125 TCCCAGATCCTTCCTGCCACTGG - Intronic
1142905024 17:3035618-3035640 CCCCAAATGCCTCTTCCCTCTGG + Exonic
1142991272 17:3732766-3732788 GCTCAAATGCCTCCTTCCCCAGG - Intronic
1145355797 17:22148591-22148613 GCCCATGTGTTTCTTCCCACCGG + Intergenic
1146341144 17:32020899-32020921 GCCCAAATCCTTCCTCACTAAGG + Intronic
1146484102 17:33229484-33229506 GCCCAAGAGCGTCCTCCCACAGG - Intronic
1147639847 17:41989804-41989826 GGCCAAATCCTTTCTGCCACTGG + Intronic
1147922679 17:43927579-43927601 GCCCAAATCCTTCCTCACTAAGG - Intergenic
1147923642 17:43933573-43933595 GCCCAAAGCTGTCCTCCCACCGG - Intergenic
1148174315 17:45550506-45550528 GCCCAAATCCTTCCTCACTAAGG - Intergenic
1148263459 17:46205023-46205045 GCCTGAATGCTTTCTCCCTCAGG + Intronic
1148274947 17:46294941-46294963 GCCCAAATCCTTCCTCACTAAGG + Intronic
1148297054 17:46512520-46512542 GCCCAAATCCTTCCTCACTAAGG + Exonic
1148361607 17:47017000-47017022 GCCCAAATCCTTCCTCACTAAGG + Intronic
1149541286 17:57470043-57470065 GCTCAGATGCTGCCTCCCCCAGG + Intronic
1149936929 17:60816960-60816982 CCCCAAGTGCTTTCCCCCACTGG + Intronic
1150405536 17:64897428-64897450 GCCCAAATCCTTCCTCACTAAGG - Exonic
1151193653 17:72416494-72416516 GCCCAAATGCCTCATCTCAGCGG + Intergenic
1152904393 17:82962427-82962449 GCCCACATGCTGTCTCACACGGG + Intronic
1153018098 18:602418-602440 GCCAAAATGATGCCTCCCATTGG - Intronic
1153978154 18:10287470-10287492 GCACAAATGCCACCTACCACTGG - Intergenic
1155932682 18:31724011-31724033 GCCCAAATTCTTCCTCGCAGAGG + Intergenic
1156968654 18:43128194-43128216 TGCCAAATGCCTTCTCCCACTGG - Intergenic
1157523947 18:48364386-48364408 GCCCAAATGCTGCCTCCTGTGGG - Intronic
1157565798 18:48678421-48678443 CCCCAAGTGCTTCCTCCCTCAGG + Intronic
1157627463 18:49062488-49062510 GCCAGCAAGCTTCCTCCCACAGG + Intronic
1159883511 18:73882380-73882402 GCCCAAATGCTCCCAGACACTGG + Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1167371080 19:49082368-49082390 GCCCCAATGTCTCCTCACACAGG - Intergenic
1167587316 19:50382434-50382456 GCCCACCTGCCTCCTCCCTCAGG + Exonic
925477728 2:4236945-4236967 TCCCAAATCCATCCTCCCATTGG + Intergenic
925930471 2:8703245-8703267 ACTCAAAGGCTTCCTCACACAGG - Intergenic
926694294 2:15760435-15760457 GCCCAAATGCTGCCTCACCCAGG + Intergenic
928872883 2:36001571-36001593 GCCCAAATAACTCCTCACACAGG - Intergenic
930030975 2:47057793-47057815 GCTCCAATGCCTCCTCCCTCAGG + Intronic
931167075 2:59759661-59759683 GTCCAAATGCTTCTTCCACCAGG + Intergenic
933297409 2:80506248-80506270 GCCCAAGTGCTGCCTCCTCCAGG - Intronic
934758977 2:96843087-96843109 ACACCCATGCTTCCTCCCACCGG + Intronic
936043689 2:109169863-109169885 ACACAGATGCTCCCTCCCACTGG + Intronic
936944639 2:117919379-117919401 GCTCAAATGCTGCCTCCTCCAGG + Exonic
939562899 2:143752679-143752701 GCCCACCTCCTTCCTTCCACAGG - Intronic
940173056 2:150849614-150849636 GCTCACATGCTTCCTCCTGCAGG - Intergenic
941025776 2:160454595-160454617 GCCCAGATCCTTCCTGCCTCAGG - Intronic
942776804 2:179591444-179591466 GGCCAACCCCTTCCTCCCACTGG - Intronic
947362956 2:229364646-229364668 TCCCAAGTTCTCCCTCCCACTGG + Intronic
947370968 2:229445218-229445240 GCCACACTGCCTCCTCCCACAGG + Intronic
947531748 2:230913298-230913320 CCCCAATTTTTTCCTCCCACGGG - Intronic
948382641 2:237561481-237561503 GCCCGCCTGCTGCCTCCCACTGG + Intergenic
1168786527 20:544345-544367 GCCCAATTCCTTCCTCCTACAGG + Intergenic
1169060128 20:2655030-2655052 GCCCACATGGTTCTACCCACAGG - Intronic
1169971258 20:11271533-11271555 GGCCAGATGGTTCCTCCCCCCGG + Intergenic
1170897647 20:20430433-20430455 GCCTGAATGCTTCCTCCAACAGG + Intronic
1171199492 20:23230012-23230034 GCCCAGATGGTTCCACCGACTGG + Intergenic
1171294684 20:24006983-24007005 GCCCTGATTTTTCCTCCCACTGG + Intergenic
1171446209 20:25206357-25206379 TCCCACATGCTGCCTCGCACTGG + Intronic
1172614740 20:36275627-36275649 GCCTAAATGCTGCCTCCTACAGG - Intergenic
1173477019 20:43367029-43367051 GCCCCACTCCTTCCTCCCTCTGG - Intergenic
1174385913 20:50188740-50188762 GCCCAAAAGCTGCCTCCTCCGGG - Intergenic
1174788049 20:53451489-53451511 GCCAAACTGCTTCCTGCCTCAGG + Intronic
1175725575 20:61316042-61316064 TGCCAAATCCTTCCTCCCCCTGG - Intronic
1177169048 21:17635522-17635544 GCCCAAGTGATTCCACCCTCTGG - Intergenic
1177959828 21:27649643-27649665 GCCCAAATTCTTCCTCCATGTGG - Intergenic
1181364960 22:22369414-22369436 GAGCAGCTGCTTCCTCCCACAGG + Intergenic
1181368027 22:22394818-22394840 GAGCAGCTGCTTCCTCCCACAGG + Intergenic
1182737697 22:32542883-32542905 GGCCAGCTGCTCCCTCCCACTGG + Intronic
1184107654 22:42377671-42377693 GCTCAAATGCTACCTCCAGCTGG - Intergenic
1185202828 22:49518498-49518520 CCCCACATGCTTCCGCCCAGAGG - Intronic
949481897 3:4502222-4502244 GCCCAAACGCTTCCTCCTCCGGG + Intronic
950121078 3:10482918-10482940 GAAGCAATGCTTCCTCCCACTGG + Intronic
950646044 3:14377386-14377408 GCTCAAATGCTACCTCCTCCTGG + Intergenic
952059716 3:29492701-29492723 TCCCATATCCTTCCTCCCACTGG - Intronic
953605024 3:44406832-44406854 TCTCAAATACTTTCTCCCACAGG - Intronic
954422351 3:50425383-50425405 GCTCAAATGCTACCTCCTCCAGG + Intronic
962200729 3:133399360-133399382 GCCAGGATGCTTCCTCCCTCTGG - Intergenic
968833061 4:2943095-2943117 GCCCACATGCTCCCTGCCTCCGG - Intronic
973170960 4:47143170-47143192 GCTAAAATGCTTCCTCCACCTGG + Intronic
976104282 4:81600404-81600426 ACCCAAATGCTGCCTTCCATGGG + Intronic
976444474 4:85114769-85114791 GACCAAAGGCTTCCTGCCAGAGG - Intergenic
977449257 4:97174370-97174392 GCCCAAATCCTTCATCTTACTGG - Intergenic
978397203 4:108294146-108294168 GCCCTAATTCTTTCTTCCACTGG - Intergenic
979848436 4:125546391-125546413 GCTCACATGCTCCTTCCCACAGG - Intergenic
980446944 4:132922064-132922086 ACCCAAATGTTTCCTCACCCAGG + Intergenic
982475187 4:155841748-155841770 GCCCCAATACTTACTCCCAAAGG - Intronic
987014435 5:13803466-13803488 ACCCACATGCTTCCTTCCAATGG - Intronic
991771432 5:70044678-70044700 CCCCGAATGCTTCTTCCCCCTGG + Intergenic
991850723 5:70920096-70920118 CCCCGAATGCTTCTTCCCCCTGG + Intergenic
992838149 5:80660380-80660402 GCTCCCATGATTCCTCCCACTGG + Intronic
998991197 5:147819471-147819493 GCCAAAATACTTCCTCCTCCAGG - Intergenic
999379418 5:151109857-151109879 TCCCAAATCCTTGCTCCAACTGG - Intronic
1001251890 5:170152965-170152987 GCCCACATGCTGGCTCCCATGGG + Intergenic
1002009270 5:176264137-176264159 GCCCATATGGCTACTCCCACAGG + Intronic
1002417132 5:179126492-179126514 GCCCGCATGCTTCCTCCCACAGG + Intronic
1005920555 6:30397333-30397355 CCCCAAATCCTTGCTGCCACAGG + Intergenic
1006084322 6:31585693-31585715 GCCAGAATGCTGCCTCCTACAGG + Intergenic
1006844288 6:37051731-37051753 GCCCACCTCCTTCCTCCCACAGG + Intergenic
1017030101 6:150213580-150213602 GCCCAACTCCTTCCAGCCACAGG - Intronic
1018369554 6:163155357-163155379 GCTCAAATGCTATCTCCCTCTGG - Intronic
1019288549 7:235874-235896 GCCCAAATGTTTCCTGGAACAGG - Intronic
1020082060 7:5291508-5291530 GCTCAAATGGTGCCTCCTACAGG + Intronic
1022224176 7:28346123-28346145 TTCCAATTGCTTCCTTCCACAGG - Intronic
1023401134 7:39793481-39793503 GCCCACATCCTGCCTCCCAGTGG - Intergenic
1024074637 7:45812212-45812234 GCCCACATCCTGCCTCCCAGTGG - Intergenic
1024075120 7:45814140-45814162 GCCCACATCCTGCCTCCCAGTGG - Intergenic
1024648479 7:51387200-51387222 GCCCACATCCTGCCTCCCAGTGG + Intergenic
1025052330 7:55741669-55741691 GCCCACATCCTGCCTCCCAGTGG + Intergenic
1025052724 7:55743217-55743239 GCCCACATACTGCCTCCCAGTGG + Intergenic
1025130001 7:56370199-56370221 GCCCACATCCTGCCTCCCAGTGG + Intergenic
1025196858 7:56940630-56940652 GCTCAAATGGTGCCTCCTACAGG - Intergenic
1025675090 7:63636307-63636329 GCTCAAATGGTGCCTCCTACAGG + Intergenic
1025977355 7:66379354-66379376 GCCCACCTTCTGCCTCCCACTGG - Intronic
1028424428 7:90670750-90670772 ACCCAAAGACCTCCTCCCACAGG + Intronic
1029662572 7:101972711-101972733 GCCCCAATGCCTCCTCCTCCAGG + Intronic
1030541232 7:110832897-110832919 GCCCTAATCCTTTCTCCTACTGG - Intronic
1031447414 7:121872481-121872503 ACACAAGTGCCTCCTCCCACAGG - Intergenic
1031966752 7:128032456-128032478 ACCCAACTGCTCCCTCCGACCGG - Intronic
1033814257 7:145053127-145053149 GCCCCAATTCTTCCTCCAAAAGG - Intergenic
1034536564 7:151729245-151729267 TCCCAAATGCTTCTACTCACTGG + Intronic
1038365169 8:26924143-26924165 TCTCAAATGCTTCCTCCTACTGG + Intergenic
1041854396 8:62434218-62434240 GCTCAAATGCTACCTCCCGAAGG - Intronic
1043395366 8:79830206-79830228 GGCCATATCCTTCCTCCCACTGG + Intergenic
1043429269 8:80179023-80179045 TCCCAAATGATACCTACCACAGG - Intronic
1044288276 8:90436786-90436808 ACCCAAATGCATCCTTCAACAGG - Intergenic
1045042619 8:98240944-98240966 GCACAAATGCTTCCTTTCACCGG - Intronic
1049571019 8:143370330-143370352 GCCCCACTGCCACCTCCCACGGG - Intronic
1052195985 9:25715625-25715647 TCACACATTCTTCCTCCCACAGG + Intergenic
1056999589 9:91495299-91495321 AACGAAATGCTTCCTCTCACAGG + Intergenic
1057867303 9:98691745-98691767 GCACAATTCCCTCCTCCCACAGG + Intronic
1058574229 9:106382804-106382826 GCCCAAGTGCTACCTCCTGCAGG - Intergenic
1058750420 9:108033818-108033840 GCTCAAATGCCTCCTCCATCAGG + Intergenic
1059464844 9:114461722-114461744 ACCGAAATGCTTCCTCCTCCAGG + Intronic
1061310943 9:129762078-129762100 CCACAAATGCTGCTTCCCACGGG + Intergenic
1062081315 9:134625205-134625227 CAGCAAATGCTTCCTCACACAGG + Intergenic
1062163688 9:135094391-135094413 GCCCAAATGCCACCTCCTCCAGG - Intronic
1062419328 9:136472111-136472133 GCCCAAATGCTTCCTCCCACAGG - Exonic
1062477985 9:136738830-136738852 GCCCAAATGCCACTTCCCCCAGG + Intronic
1190736959 X:53262106-53262128 GTCCACAAGCTTCCTCCCCCAGG - Intronic
1195129097 X:101837345-101837367 CCCCCACTGCTCCCTCCCACTGG - Intronic
1197761446 X:130031007-130031029 GGCCAAGGGCTTCTTCCCACAGG + Intronic
1200068609 X:153517167-153517189 GTCCAAATGCGTCTTCCCAGAGG - Intergenic
1200115032 X:153766174-153766196 GCCCCAGTGCTTCCTCGCCCTGG + Exonic