ID: 1062419487

View in Genome Browser
Species Human (GRCh38)
Location 9:136472985-136473007
Sequence ACAAGGACATTCAGCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062419487_1062419498 30 Left 1062419487 9:136472985-136473007 CCAGCAGAGCTGAATGTCCTTGT 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1062419498 9:136473038-136473060 GGAACCTACACAGGTCTGAGGGG No data
1062419487_1062419490 -2 Left 1062419487 9:136472985-136473007 CCAGCAGAGCTGAATGTCCTTGT 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1062419490 9:136473006-136473028 GTATGGAAATAAAAAGTGCCTGG No data
1062419487_1062419491 -1 Left 1062419487 9:136472985-136473007 CCAGCAGAGCTGAATGTCCTTGT 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1062419491 9:136473007-136473029 TATGGAAATAAAAAGTGCCTGGG No data
1062419487_1062419494 21 Left 1062419487 9:136472985-136473007 CCAGCAGAGCTGAATGTCCTTGT 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1062419494 9:136473029-136473051 GCTCCTTCTGGAACCTACACAGG No data
1062419487_1062419492 9 Left 1062419487 9:136472985-136473007 CCAGCAGAGCTGAATGTCCTTGT 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1062419492 9:136473017-136473039 AAAAGTGCCTGGGCTCCTTCTGG No data
1062419487_1062419496 28 Left 1062419487 9:136472985-136473007 CCAGCAGAGCTGAATGTCCTTGT 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1062419496 9:136473036-136473058 CTGGAACCTACACAGGTCTGAGG No data
1062419487_1062419497 29 Left 1062419487 9:136472985-136473007 CCAGCAGAGCTGAATGTCCTTGT 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1062419497 9:136473037-136473059 TGGAACCTACACAGGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062419487 Original CRISPR ACAAGGACATTCAGCTCTGC TGG (reversed) Intronic
901251256 1:7782262-7782284 GCAGGTACTTTCAGCTCTGCCGG + Intergenic
901710501 1:11110883-11110905 ACTAGGACAGCCAGTTCTGCTGG - Intronic
903168573 1:21538227-21538249 CCAAGGGCATGCAGCTCAGCAGG - Intronic
903690332 1:25168834-25168856 ACACAGATATTCTGCTCTGCCGG - Intergenic
904105837 1:28082581-28082603 TTAAGGACATTCATCTCTTCAGG - Intronic
904789526 1:33008487-33008509 CCATGGACACTCAGCGCTGCCGG - Intronic
905834916 1:41109842-41109864 ACAAAGACCGTCAGCTCTGTTGG + Intronic
906833769 1:49061110-49061132 CCAATGACTTTCAGCTCTCCTGG + Intronic
908665135 1:66481515-66481537 ACAGGGACATTTAAGTCTGCAGG - Intergenic
910311568 1:85830335-85830357 ACAGGGACATTTAAGTCTGCAGG + Intronic
910552517 1:88492291-88492313 ACAAGAACTTTCAACACTGCTGG + Intergenic
910772540 1:90844444-90844466 ACAAGGCCAGACAGCTCTTCAGG + Intergenic
911822894 1:102442672-102442694 ACAGGGACATTTAAGTCTGCAGG - Intergenic
911823918 1:102456368-102456390 TCCAGGACATTCAGCTCTGTTGG + Intergenic
913093809 1:115497704-115497726 ACAAGGCCACTCAGGTTTGCAGG + Intergenic
913969189 1:143401607-143401629 CCAGGCACATTCATCTCTGCGGG + Intergenic
914063566 1:144227206-144227228 CCAGGCACATTCATCTCTGCGGG + Intergenic
914115584 1:144739148-144739170 CCAGGCACATTCATCTCTGCGGG - Intergenic
914374938 1:147064502-147064524 ACAGGGACATTTAAGTCTGCAGG - Intergenic
914804606 1:150983048-150983070 GCCAGGAAATTCAGCTCTGTGGG + Intronic
915230416 1:154441725-154441747 CCAAGGACCTTCAGCTCTCAAGG + Intronic
922038086 1:221869440-221869462 GCAAGGACATAAAGATCTGCAGG + Intergenic
922707279 1:227796038-227796060 ACACGGGGACTCAGCTCTGCTGG + Intergenic
923126050 1:231035491-231035513 ACAAAGACCTTCAGCCCTGGGGG - Intronic
923358528 1:233184403-233184425 ACACTGACATTCAACTTTGCTGG - Intronic
924580908 1:245323792-245323814 TCAAGGACATCCAGCTGTACGGG + Intronic
1066565419 10:36717002-36717024 ACAAGAACCCACAGCTCTGCTGG - Intergenic
1066761483 10:38757854-38757876 ACTAGGAAATTCAGGTATGCTGG + Intergenic
1069139152 10:64802319-64802341 CCCATGACATTCTGCTCTGCTGG - Intergenic
1069837930 10:71320740-71320762 ACCAGGACATTCTCCCCTGCTGG - Intronic
1071169381 10:82846059-82846081 AGGAGGACATTCATCTCTCCGGG - Intronic
1071372260 10:84963877-84963899 GCCAGGACACTCATCTCTGCTGG - Intergenic
1071572501 10:86705715-86705737 ACAAGGTCTTTCAGATCTGCAGG + Intronic
1072751593 10:97984465-97984487 AAAATAAAATTCAGCTCTGCAGG - Intronic
1075184909 10:120247344-120247366 ACAAGAAAATTCAGCTGTGATGG + Intergenic
1075810295 10:125220199-125220221 CCAAGGACATCCAGATCTACGGG + Intergenic
1080561164 11:33464455-33464477 ACATGCACACACAGCTCTGCAGG - Intergenic
1081590442 11:44419219-44419241 ACAAGGACATTCCTCTCTACAGG + Intergenic
1084586081 11:70063478-70063500 ACAAGGACATTGCCCTTTGCTGG + Intergenic
1084755943 11:71238699-71238721 ACAGTGACACTCAACTCTGCTGG + Intronic
1085521533 11:77142019-77142041 ACAACCACATTCAGCACTGATGG - Intronic
1086770093 11:90751705-90751727 TCATGGAGCTTCAGCTCTGCTGG + Intergenic
1086962040 11:92987751-92987773 AAAGGGACAGTGAGCTCTGCAGG - Intergenic
1092064153 12:5575833-5575855 ACCAGGAGGTTCAGTTCTGCAGG - Exonic
1094157789 12:27355702-27355724 CCAAGGACATAGAGCTCGGCTGG - Intronic
1098384672 12:69906375-69906397 GGAAGGACATGCAGCTCTGACGG + Intronic
1098683922 12:73395401-73395423 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1098848656 12:75568404-75568426 AGAAAGACATTCAGCTGTGGTGG - Intergenic
1099382075 12:81967392-81967414 AAAAGGACATTCTGATCTTCAGG - Intergenic
1100400203 12:94222795-94222817 ACAGGGACAGTCAGCTCAGAGGG - Intronic
1101537169 12:105628854-105628876 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1101552643 12:105776659-105776681 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1102780931 12:115563738-115563760 ACAAGCTCATTCAGGTCTGATGG - Intergenic
1103032528 12:117628745-117628767 ACAGGGACATTTAAGTCTGCAGG + Intronic
1108181112 13:47840968-47840990 CCAAGGACACTCCGGTCTGCTGG + Intergenic
1109903178 13:68801279-68801301 ACAAGGAAATTCAGATCATCAGG - Intergenic
1111021365 13:82456814-82456836 ATATGGAGATTCAACTCTGCTGG + Intergenic
1114070648 14:19103020-19103042 ACATGGGCATTCATCTCTACGGG - Intergenic
1114091613 14:19296986-19297008 ACATGGGCATTCATCTCTACGGG + Intergenic
1117395094 14:55301109-55301131 ACAAGAAAAATCAGCTCTGTAGG + Intronic
1119584685 14:75822140-75822162 ACCAGGACATTGGGCTGTGCAGG - Intronic
1120043889 14:79784872-79784894 AGAGTGACATTCAGCCCTGCTGG - Intronic
1124260239 15:28183106-28183128 ACGAGGACTTTCAGCTTAGCTGG - Intronic
1127358611 15:58225613-58225635 ACAAGGACCTGCAGTGCTGCAGG - Intronic
1128620774 15:69147799-69147821 ACAAGAAGATACAGCTCTCCTGG - Intergenic
1128784916 15:70387726-70387748 ACCAGGACCTCCATCTCTGCTGG - Intergenic
1133454897 16:5933478-5933500 ACAAGGAGATTCAACCCTGACGG - Intergenic
1137037367 16:35578043-35578065 ACAAGGACATTCAAATAAGCAGG + Intergenic
1139843666 16:69903107-69903129 AGAAGGACATTGAGCTTTGCGGG + Intronic
1140643351 16:77002746-77002768 ACAAAGACCTTCAGCTCAGTTGG - Intergenic
1146577472 17:34007351-34007373 ACAAGCACATTCACCTCCCCAGG - Intronic
1149986498 17:61351665-61351687 ATAAGGCCATTGAGCTCTGTTGG - Intronic
1150395960 17:64822167-64822189 ACAAGGACATGAGGCCCTGCAGG + Intergenic
1151263764 17:72937674-72937696 TCAAGGAGATTCAGCCCTCCTGG - Intronic
1163594210 19:18211485-18211507 ACACGTACATTCAGCCCTGTGGG - Intronic
1165061534 19:33207352-33207374 ACAAGGACAGAAAGGTCTGCAGG + Exonic
1165170489 19:33888540-33888562 ACCAGCACCCTCAGCTCTGCTGG + Intergenic
1167372511 19:49091879-49091901 ACATAGACATTCAGCTGTGCCGG + Intronic
926773769 2:16402075-16402097 ACAATGACATTGAGATCTGTTGG - Intergenic
927946307 2:27137239-27137261 ACCAGGAGCTTCAGGTCTGCAGG - Exonic
932862768 2:75311877-75311899 ACAAGGACATAAGCCTCTGCAGG - Intergenic
932955058 2:76342254-76342276 CCAAGGTCATCCAGCTCTCCAGG + Intergenic
933764435 2:85697271-85697293 ACAAGGACAGTTAGCCCTGCTGG - Intronic
934173882 2:89562511-89562533 CCAGGCACATTCATCTCTGCAGG + Intergenic
934284196 2:91636860-91636882 CCAGGCACATTCATCTCTGCAGG + Intergenic
934689241 2:96345601-96345623 TCTGGGACATTCAGCTTTGCCGG - Intronic
935056616 2:99573191-99573213 ACAAGGACATTCAGATCTCCTGG - Intronic
935327794 2:101953699-101953721 ACATGGAACTTCAGCTGTGCTGG - Intergenic
935358827 2:102230383-102230405 ACAAGGAGTTTCAGCTATGTTGG + Intronic
935647810 2:105355380-105355402 ACAATGACAATCGTCTCTGCAGG + Intergenic
935690458 2:105726841-105726863 ACAAGGGCATTCAGCCCAGGTGG - Intergenic
935981058 2:108628072-108628094 TCAAGAACACTCAGCACTGCAGG - Intronic
938161573 2:128989065-128989087 ACAAGGAGATACAGCTATGACGG - Intergenic
938651503 2:133388570-133388592 ACAGGGACATTTAAGTCTGCAGG + Intronic
939790131 2:146562116-146562138 ACAGAGACATTCAGCTCTGGAGG + Intergenic
941846685 2:170140988-170141010 ACATGGGCATTCAGCACTACAGG + Intergenic
942056906 2:172192808-172192830 ACAGGGACATTTAAGTCTGCAGG + Intergenic
945354580 2:208824190-208824212 CCCAGGACATTGAGATCTGCTGG + Intronic
946047315 2:216832033-216832055 ACAAATACATTCAGCTTTGTGGG + Intergenic
948625497 2:239265717-239265739 TCAAGGTCAGCCAGCTCTGCAGG + Intronic
948751258 2:240134688-240134710 ACAAGGGCATGCAGCTATGTGGG - Intronic
1168981394 20:2006960-2006982 AAAAGGATATTGAGGTCTGCTGG - Intergenic
1169926173 20:10786782-10786804 TCAAGGACATTCAGCTTCACTGG + Intergenic
1171377263 20:24702018-24702040 ACATGCACATATAGCTCTGCGGG - Intergenic
1173367940 20:42404581-42404603 ACAAGGCCATTCTGCTCTCTTGG + Intronic
1174875607 20:54223382-54223404 ACATGGAGACTCAGCTCTGTGGG - Intronic
1175055399 20:56193101-56193123 AGAAGGACGCTCAGCCCTGCTGG - Intergenic
1176267025 20:64215021-64215043 ACAGGCACCTTCAGCCCTGCAGG + Intronic
1178473447 21:32916142-32916164 GAAAGGACAATCTGCTCTGCTGG + Intergenic
1179209457 21:39313284-39313306 ATAAGGAAGTACAGCTCTGCGGG + Exonic
1180371017 22:12036892-12036914 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1180489116 22:15825485-15825507 ACATGGGCATTCATCTCTACGGG - Intergenic
1183275383 22:36893469-36893491 ACAAGTCCATCCTGCTCTGCAGG - Intergenic
1183804945 22:40200806-40200828 ACAAGGCCATGCAGCTCTAGTGG - Intronic
1185161267 22:49231326-49231348 AAAAGTAAATACAGCTCTGCTGG - Intergenic
950047228 3:9956069-9956091 ACAACAACTTTCAGCTCTGTTGG - Intergenic
951601003 3:24375759-24375781 CCAGGGACATTGAGGTCTGCTGG + Intronic
952984009 3:38761368-38761390 ACAATGACCTTCAGGCCTGCGGG + Exonic
953784091 3:45897426-45897448 ACAAGGACATTGTGTCCTGCTGG - Intronic
955398766 3:58576195-58576217 AAATGGACAAGCAGCTCTGCTGG - Intronic
956862426 3:73338398-73338420 ACAGGGACATTTAAGTCTGCAGG + Intergenic
956926188 3:73991302-73991324 ACAGGGACATTTAATTCTGCAGG - Intergenic
957228608 3:77481198-77481220 CCAAAGACAGTCAGCTCTGCTGG - Exonic
958887026 3:99738636-99738658 ACAGGGACATTTAAGTCTGCAGG + Intronic
960169050 3:114437133-114437155 ACAAGGACCCTAGGCTCTGCTGG + Intronic
961738236 3:129015589-129015611 ACACGGACACTCAGCTCTCGGGG - Intronic
962956386 3:140270722-140270744 ACAAGGACACTCAGCATTTCTGG + Intronic
964644488 3:158943938-158943960 ACATGCAGAGTCAGCTCTGCTGG + Intergenic
965364699 3:167784102-167784124 AGATGGACCTGCAGCTCTGCAGG - Intronic
966008336 3:175045260-175045282 AAAAGGACATTCATGTCTTCGGG - Intronic
967248529 3:187513294-187513316 ACAGGGACATTTAAGTCTGCAGG - Intergenic
968435644 4:587080-587102 ACACGCACATTCAGCTATGATGG + Intergenic
968520215 4:1031693-1031715 CCAGGGACATCCAGCCCTGCAGG + Intergenic
968816700 4:2825119-2825141 GCAAGGCCATCCAGCTCTGCAGG - Exonic
969407072 4:7000584-7000606 ACAGAGTCCTTCAGCTCTGCTGG - Intronic
970011496 4:11464597-11464619 ATACGGAAAGTCAGCTCTGCTGG - Intergenic
970120659 4:12748859-12748881 ACAGGGACATTTAAGTCTGCAGG - Intergenic
970134184 4:12904017-12904039 ACAGGGACATTTAAGTCTGCAGG - Intergenic
976676679 4:87710965-87710987 ACAGGGACATTTAAGTCTGCAGG - Intergenic
976921301 4:90447087-90447109 ACATGGATTTTCAACTCTGCAGG + Intronic
978090029 4:104703793-104703815 ACAGGCACATTCTGCTCTCCCGG + Intergenic
980204930 4:129705423-129705445 GCAAGGAAATTCTGCTCTGTGGG + Intergenic
981096678 4:140789139-140789161 ACAAGGATATTCAGAGTTGCTGG + Intergenic
983364612 4:166769721-166769743 ACAGGGACATTTAAGTCTGCAGG + Intronic
985808902 5:2068811-2068833 ACAACGACACCCAGCTGTGCAGG + Intergenic
986092681 5:4525567-4525589 TGAAGGTCATTCAGCTCTCCAGG - Intergenic
987242751 5:16017493-16017515 GTAAACACATTCAGCTCTGCAGG - Intergenic
988815569 5:34830960-34830982 ACAGGGACTTTCACCTCTGCTGG - Intronic
996788642 5:127268696-127268718 ACAGGGACATTTAAGTCTGCAGG - Intergenic
998376725 5:141695727-141695749 ACAAGGACCTTAATCACTGCTGG - Intergenic
1003332794 6:5143688-5143710 ACAAGGCAATACAGCTCTGATGG + Intronic
1003556270 6:7142375-7142397 ACAAGGGCGTCCAGCTTTGCGGG - Intronic
1004578357 6:16922434-16922456 ACCAGGACATTGACCTCTGCTGG + Intergenic
1004652638 6:17625807-17625829 ACAACCACATCTAGCTCTGCAGG - Exonic
1005341539 6:24848075-24848097 ACATGGACATTCTCCTCTGAAGG + Exonic
1005654873 6:27925303-27925325 AACAGGACATTCAGATCTTCAGG + Intergenic
1005894213 6:30164043-30164065 ACGAGGCCATTCAGCCCTACCGG + Exonic
1007166551 6:39832498-39832520 ATAACGACACTCAGCTGTGCAGG + Intronic
1007915333 6:45556369-45556391 ACAAGAACATCCTGCTCTGTTGG - Intronic
1007955108 6:45911070-45911092 TCACCGACATTCAGCTCTGCAGG + Intronic
1008787213 6:55183218-55183240 AGAAGGACACTTAGCTCTGCTGG + Intronic
1009191517 6:60635321-60635343 ACAGGGACATTGAAGTCTGCGGG + Intergenic
1011807377 6:91087388-91087410 ATAATGACATTCTACTCTGCAGG - Intergenic
1012459768 6:99447653-99447675 ACAGGGACATTCAAGTCTGCAGG - Intronic
1014609135 6:123519300-123519322 ACCAGAACATTCAGCTCAACTGG + Intronic
1018573403 6:165233751-165233773 ACAGGGACACACAGCCCTGCAGG + Intergenic
1018705304 6:166459997-166460019 CCACGGAACTTCAGCTCTGCGGG + Intronic
1019155816 6:170038194-170038216 ACATGGACATTCTGCTGTCCTGG + Intergenic
1023455976 7:40339280-40339302 ACAGGGACATTTAAGTCTGCAGG + Intronic
1023925246 7:44664220-44664242 AGAAGGACTTCCACCTCTGCTGG - Intronic
1023990017 7:45123321-45123343 AACAGGACATGCAGCTCTGCTGG - Intergenic
1026131670 7:67626108-67626130 AGAAGGACATTTTTCTCTGCGGG + Intergenic
1033410815 7:141115738-141115760 CCAAGGGCATTCACCTCTGAGGG + Intronic
1033855951 7:145561496-145561518 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1034675552 7:152890429-152890451 ATAAGGACACTCATCTCTTCAGG + Intergenic
1036536235 8:9655350-9655372 ACAGGGACATTTAAGTCTGCAGG - Intronic
1039453118 8:37691573-37691595 ACCAGGACAGCCAGCCCTGCAGG - Intergenic
1041737102 8:61122830-61122852 AAAAGGACACTCAACTCTGACGG + Intronic
1042515800 8:69657576-69657598 AGTGTGACATTCAGCTCTGCTGG + Intronic
1042884580 8:73533885-73533907 TCAAGGACTTTTAGCTCTGCAGG - Intronic
1043859143 8:85295714-85295736 ACCAGGACATTCACCTCAGAAGG - Intergenic
1044601420 8:94009155-94009177 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1044874044 8:96646634-96646656 CCAAGGTCATCCAGCTCTTCTGG - Intronic
1046497368 8:115033155-115033177 TCAAGAACATTGAGCTATGCTGG + Intergenic
1048091975 8:131250930-131250952 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1048246792 8:132812347-132812369 ACAATCACATTCACCTCAGCAGG - Intronic
1048893037 8:138964845-138964867 ACAAAGCCATTCACATCTGCTGG + Intergenic
1050436523 9:5616383-5616405 TCAAGAAAATTCAGATCTGCTGG + Intergenic
1051539828 9:18203153-18203175 AAGAGGACAGTAAGCTCTGCTGG + Intergenic
1052647405 9:31254211-31254233 ACAAGCACACGCAGTTCTGCAGG + Intergenic
1053196486 9:36123095-36123117 AAAAAGACATTCAGGACTGCTGG + Exonic
1057214101 9:93218726-93218748 ACATGGACAGGCAGCTGTGCAGG - Intronic
1057297883 9:93860005-93860027 ACAGGGCCATGCAGCTCTGAGGG - Intergenic
1057494895 9:95553222-95553244 ACAAGGACATTCCCATCTGCGGG - Intergenic
1058525137 9:105850036-105850058 ACAAGCACATGCAGTTCTGAAGG + Intergenic
1059349385 9:113653844-113653866 ACAAGTACTTGCAGCTTTGCAGG - Intergenic
1061602207 9:131678709-131678731 ACAGGGACTGTCAGCACTGCAGG + Intronic
1062419487 9:136472985-136473007 ACAAGGACATTCAGCTCTGCTGG - Intronic
1062582029 9:137232997-137233019 ACCCGGACAGTCAGCACTGCTGG - Exonic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1186598030 X:11005958-11005980 ACAAGGTCATTAAGCGTTGCTGG - Intergenic
1186914607 X:14206412-14206434 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1186968062 X:14809784-14809806 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1187009131 X:15262533-15262555 ACAAGGACTTTGACCTCAGCAGG + Intronic
1187187539 X:17001607-17001629 AAAAGAAAATTCAGCTCTGTAGG + Intronic
1189045587 X:37587329-37587351 ACAGGGACATTTAAGTCTGCAGG + Intronic
1189237379 X:39497722-39497744 ACAAGGAAATGCAGCGGTGCTGG + Intergenic
1191114838 X:56841709-56841731 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1191765614 X:64695376-64695398 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1192352491 X:70368782-70368804 ACAGGGACATTTAAGTCTGCAGG + Intronic
1197817597 X:130514188-130514210 TCAAGGAAATTCAAATCTGCTGG - Intergenic
1198008500 X:132524829-132524851 ACAGGGACATTCACCTCTGCTGG - Intergenic
1199433846 X:147790479-147790501 ACAAGTAGAATCAACTCTGCTGG - Intergenic
1202105053 Y:21355008-21355030 ACAGGGACATTTAATTCTGCAGG - Intergenic
1202242062 Y:22781186-22781208 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1202395046 Y:24414930-24414952 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1202475738 Y:25255162-25255184 ACAGGGACATTTAAGTCTGCAGG - Intergenic