ID: 1062419720

View in Genome Browser
Species Human (GRCh38)
Location 9:136474373-136474395
Sequence CAGCTCCGAAAACATGGCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062419715_1062419720 11 Left 1062419715 9:136474339-136474361 CCTGTCCCTGTGCGGGCAGACTT 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1062419720 9:136474373-136474395 CAGCTCCGAAAACATGGCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 102
1062419716_1062419720 6 Left 1062419716 9:136474344-136474366 CCCTGTGCGGGCAGACTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 90
Right 1062419720 9:136474373-136474395 CAGCTCCGAAAACATGGCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 102
1062419718_1062419720 5 Left 1062419718 9:136474345-136474367 CCTGTGCGGGCAGACTTTCTGGA 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1062419720 9:136474373-136474395 CAGCTCCGAAAACATGGCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062419720 Original CRISPR CAGCTCCGAAAACATGGCTT TGG Exonic
904273371 1:29364756-29364778 CAGCTCTGCAAACATGTCTCGGG - Intergenic
910424346 1:87103928-87103950 AGGCTGCTAAAACATGGCTTAGG - Intronic
910441317 1:87255239-87255261 CTGCTAGGAAAACATGGCCTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
918117865 1:181511944-181511966 CAGTTCAGAAAATATGGCTGAGG - Intronic
920151821 1:203915802-203915824 CAGCTGCAAAATCATGGCATTGG + Intergenic
922220338 1:223553418-223553440 CAGCTCAGCTAACCTGGCTTGGG - Intronic
1064140349 10:12785098-12785120 CAGCTCCAAAACGCTGGCTTTGG + Intronic
1068430786 10:56929891-56929913 CAGCCCAGAAAATATTGCTTAGG + Intergenic
1069630629 10:69895146-69895168 CAGCTCAGAGAAGGTGGCTTGGG + Intronic
1069949747 10:72010706-72010728 CAGCTCTGAAAACATGACCGTGG + Exonic
1075468122 10:122667174-122667196 CAACTCCAAAGACATGACTTTGG + Intergenic
1076674420 10:132140781-132140803 AAGCTCCCATGACATGGCTTGGG + Intronic
1076942052 10:133616488-133616510 CAGCTATGAACACATGGCCTGGG - Intergenic
1077846857 11:6034410-6034432 CAGTTGGGAAAACATGGCTTGGG + Intergenic
1085800126 11:79581711-79581733 CAGCTGCCACAAGATGGCTTGGG + Intergenic
1086391653 11:86371216-86371238 AAGCTCAGAAACCATGGCCTAGG + Intergenic
1087957465 11:104306319-104306341 AAGATCCTAAAACATGGCCTGGG + Intergenic
1089028853 11:115301606-115301628 CTGCTCACAGAACATGGCTTGGG - Intronic
1089312206 11:117566002-117566024 GAGCTCTGAGAACCTGGCTTAGG - Intronic
1091558948 12:1595559-1595581 AAGCTCCTAAAACAAGGCTTAGG - Intronic
1094690337 12:32762230-32762252 CAGTCCCGACAACATGGCCTGGG - Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1101747570 12:107555156-107555178 CAGCTCCTCTAACATGGCTCAGG + Intronic
1107217028 13:37934154-37934176 CAGCTCCAAAAAGATGGATGTGG + Intergenic
1108739103 13:53316744-53316766 CAGCTCCGTAAATATGGCATTGG - Intergenic
1111877808 13:93918677-93918699 CAGCTCTGTCAACAGGGCTTAGG + Intronic
1115068034 14:29289173-29289195 CAGATCAGAAAACATTGCTCTGG - Intergenic
1117733910 14:58750884-58750906 CAGGTCCGTAGCCATGGCTTGGG - Intergenic
1117783157 14:59255616-59255638 CAGTTCTGAAAACATGGGTGTGG + Intronic
1118607183 14:67513229-67513251 CAGCTCCGAATAAATAGCTTGGG + Intronic
1119487793 14:75003077-75003099 CAGCTCCGAGGAAATGGCTCGGG + Exonic
1127906671 15:63381365-63381387 CAGCTCTGAAGATGTGGCTTGGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130932193 15:88437592-88437614 CAGTTGCCAAAACATGCCTTTGG + Intergenic
1131128082 15:89873230-89873252 CAGCTCCAAAAAGATTGATTAGG - Intronic
1131726428 15:95230621-95230643 CATCACCCAAAACATTGCTTTGG - Intergenic
1134852542 16:17492415-17492437 CAGCTCTGAAAAGCTTGCTTTGG + Intergenic
1135860007 16:26047652-26047674 TAGCTGAGAAAACAGGGCTTTGG - Intronic
1136158408 16:28401384-28401406 CAGCTCCTCAAACCTGGGTTGGG + Exonic
1136204679 16:28713899-28713921 CAGCTCCTCAAACCTGGGTTGGG - Exonic
1137621869 16:49881543-49881565 CAGCTCTGAACACAGGGCTCTGG - Intergenic
1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG + Intergenic
1141601074 16:85126785-85126807 CTGCTCAGAAAACACGGCTGGGG + Intergenic
1144663019 17:17083634-17083656 CATCTGCAAAAAAATGGCTTAGG - Intronic
1203164832 17_GL000205v2_random:84337-84359 TAGCTCACAAAACATGGCTGGGG - Intergenic
1153145013 18:2021390-2021412 CAACTCTGAAAACATGTCTGAGG + Intergenic
1156027492 18:32671537-32671559 CAGCTGGGAAAATATGACTTTGG + Intergenic
1156968895 18:43131080-43131102 CAGCTGCCAACACAAGGCTTTGG + Intergenic
1157429256 18:47611048-47611070 CATCTCCTAAATCTTGGCTTTGG + Intergenic
1162606057 19:11708916-11708938 CAGCTCCAAAAACACTGCTCAGG + Intergenic
1162677091 19:12307242-12307264 CGGCTCCAAAAACACAGCTTGGG + Intergenic
1166654477 19:44600128-44600150 CAGCCCCTCAAACATGACTTTGG - Intergenic
926313433 2:11692075-11692097 CAGATCGGAAAACAAGGGTTAGG - Intronic
931257162 2:60583735-60583757 CGGCTGGGAAAGCATGGCTTTGG + Intergenic
932605288 2:73161454-73161476 CAGCTCCAAAAACAAAGCTGGGG + Intergenic
934110420 2:88736994-88737016 CAGCTGTGAAACCCTGGCTTTGG + Intronic
935289971 2:101602084-101602106 CAGCTCCGAAATATTGTCTTGGG + Intergenic
939254542 2:139725182-139725204 CATCTCCAAAGACATGACTTAGG - Intergenic
946765696 2:223037951-223037973 CATTTCCGTAAACATGGCTGGGG - Intergenic
1172366001 20:34350021-34350043 CATCTCTGAAAACAGGGTTTAGG + Intergenic
1176406918 21:6374750-6374772 TAGCTCACAAAACATGGCTGGGG + Intergenic
1178491727 21:33056864-33056886 CAGCTCAGATAAGATGACTTTGG + Intergenic
1182032172 22:27167998-27168020 CAGCTCTGCAAACATGGTTGTGG - Intergenic
953883603 3:46703803-46703825 CAGGTCCGTAAACATGGATTAGG - Intronic
959685428 3:109140739-109140761 CAGCTCCAAAAACATGTCCAAGG + Intergenic
960454076 3:117848816-117848838 CAACTCTGAAAACATGCCTTGGG + Intergenic
960698586 3:120419212-120419234 CTGCTCCAAAAACATGGGTAGGG + Intronic
965272594 3:166638270-166638292 CAGGTCCGCAGTCATGGCTTGGG - Intergenic
965919153 3:173891557-173891579 CAGCTAGGAAAACATGGGTTTGG - Intronic
968492715 4:898942-898964 CAGCTCTGATAACAGGGCATGGG + Intronic
970140295 4:12974760-12974782 AGGCTTTGAAAACATGGCTTGGG + Intergenic
972091006 4:35283491-35283513 CGGTACCGAAAGCATGGCTTGGG - Intergenic
975184398 4:71384510-71384532 CAGCTCACAAAACATGACTTGGG - Intronic
976311245 4:83615398-83615420 CAGCTCCGCAAACTGGGCTAAGG + Intergenic
977730515 4:100345688-100345710 GAGCTTCTAAAACATGGCTGTGG + Intergenic
980661002 4:135857857-135857879 CAACTCAGAAAACAAGACTTTGG - Intergenic
986840176 5:11687555-11687577 CTGGACCTAAAACATGGCTTAGG + Intronic
992015362 5:72569887-72569909 CAGCTCTGAAGACAGGGATTGGG - Intergenic
996306883 5:122057241-122057263 CAGCTCCAAAAACAATGTTTTGG + Intronic
996355209 5:122588189-122588211 CAGCTCTGCAAACATGCCTAAGG + Intergenic
996642304 5:125770726-125770748 CAGCTCCCAAGACTTGGCTCAGG + Intergenic
998079058 5:139259640-139259662 CAGCTCTAACAAAATGGCTTTGG + Intronic
998672845 5:144373096-144373118 CAACTCTGAAATCCTGGCTTAGG + Intronic
1004886592 6:20057493-20057515 CACCTGCGAAAACATGGATGAGG - Intergenic
1005254559 6:23986819-23986841 AGGATCAGAAAACATGGCTTAGG + Intergenic
1008900199 6:56604997-56605019 CAGTTATTAAAACATGGCTTGGG + Intronic
1011572756 6:88756773-88756795 AAACTCAAAAAACATGGCTTTGG + Intronic
1015802822 6:137077855-137077877 CAGCCCCTAAAACAGTGCTTGGG - Intergenic
1018150214 6:160930921-160930943 CAGCTCCCAAAACCTGTCGTGGG + Intergenic
1019170613 6:170131357-170131379 CAGCTGAGAAAATAGGGCTTTGG - Intergenic
1020900404 7:13996600-13996622 CATTTCCCAAAACATTGCTTAGG - Intergenic
1022172287 7:27841770-27841792 AAGCTCCAAATAAATGGCTTTGG - Intronic
1023236668 7:38097787-38097809 CACCTCCGAAACTATGGCTTGGG + Intergenic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1023545422 7:41313234-41313256 CAGTTTGGAAAACATGGCTAAGG - Intergenic
1024550887 7:50561590-50561612 CAGCATCTAAAACATGGTTTGGG + Intronic
1027122915 7:75534835-75534857 CAGCAACAAAATCATGGCTTAGG - Exonic
1035399204 7:158553805-158553827 CAGCTCCTAACACATTGCATCGG + Intronic
1040796794 8:51296473-51296495 AAGCTCCAAAAACAAGCCTTGGG - Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1049161693 8:141102318-141102340 CAGCTCCCCAAACCAGGCTTGGG - Intergenic
1055453481 9:76452503-76452525 CTGCACAGAAAGCATGGCTTGGG + Intronic
1062259123 9:135649766-135649788 CATCTCCAAATACATGACTTAGG - Intergenic
1062419720 9:136474373-136474395 CAGCTCCGAAAACATGGCTTTGG + Exonic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1194503543 X:94706207-94706229 CATCTCCAAAGACATGACTTAGG - Intergenic
1194879247 X:99229964-99229986 CAGCTACAAAAATATGCCTTAGG + Intergenic
1194965738 X:100286787-100286809 CAGCTCCAAAAAAATGTATTGGG + Intergenic
1195839465 X:109157213-109157235 CAGCTCCCTAAACAAGGCTCAGG - Intergenic
1196211132 X:112996938-112996960 CAGCTCTGAAATCATGATTTAGG - Intergenic
1200951422 Y:8902938-8902960 CAGCTGCAAAGACATGGCTCTGG + Intergenic
1202161525 Y:21940374-21940396 CAGCTGCGAAGACATGGCTCTGG - Intergenic
1202229831 Y:22645999-22646021 CAGCTGCGAAGACATGGCTCTGG + Intergenic
1202313325 Y:23550166-23550188 CAGCTGCGAAGACATGGCTCTGG - Intergenic
1202557478 Y:26120429-26120451 CAGCTGCGAAGACATGGCTCTGG + Intergenic